terça-feira, novembro 04, 2008

A ciência é a mesma?

Num raro exemplo de comentário sucinto e pertinente, o Jónatas Machado escreveu que «A ciência é a mesma para criacionistas e evolucionistas.»(1) Concordo que devia ser mas parece-me que não é. Parece-me até que para os criacionistas a ciência é precisamente o contrário daquilo que é para os cientistas.

Para um cientista a ciência organiza o conhecimento revelando padrões regulares, correlações e mecanismos que sugerem relações causais. Para compreender a relação entre o tabaco e o cancro examina grupos de pessoas, estima correlações e testa os efeitos do tabaco em animais. O tio Jeremias pode ter fumado três maços por dia até aos noventa mas importa mais o padrão que os dados revelam do que as anomalias pontuais.

O criacionista vê a ciência como uma colecção de anomalias. Ignora o enorme conjunto de resultados fiáveis, e o padrão que estes formam, e foca aquela rocha que deu problemas com aquele método ou aquele resultado pontual que não se sabe como surgiu. Enquanto o cientista estuda o cancro o criacionista apregoa, repetidamente, que o tio Jeremias morreu de perfeita saúde.

O cientista procura explicações genéricas que abarquem fenómenos diferentes. A unificação do conhecimento sob esquemas explicativos aplicáveis a muitos casos é um dos objectivos da ciência e uma das suas grandes vitórias. O criacionista não gosta de explicações e prefere explicacinhas. Aqui deus mexericou na radioactividade, ali remexeu a água, acolá deu um empurrão à luz e assim por diante. Cada cor seu sabor.

O cientista investiga para conhecer e ganhar confiança nas ideias que tem acerca da realidade. As hipóteses que formula podem ser verdade mas também podem não ser, e é a evidência que o ajuda a decidir. Nunca de uma vez por todas mas sempre tentativamente e sempre procurando lugar para melhorias. O criacionista só procura lugar onde enfiar os seus milagretes. A verdade, julga ele, já a tem toda, e por isso não lhe interessa um método para a procurar. O que ele precisa é de desculpas para justificar uma crença tão contrária ao que se observa.

Para o cientista a ciência é uma invenção humana excepcional que ajuda a conhecer o universo, corrigir erros e aproximar-nos da verdade. Para o criacionista a ciência é vento no capachinho. Disfarça, diz que segura o cabelo só porque não se quer despentear, mas o desconforto é evidente.

1- Em Miscelânea Criacionista: ciência operacional e ciência histórica.

80 comentários:

  1. Claro, o Jónatas nem se apercebe que em questões como o decaímento através da radioactividade, a velocidade de luz, etc., se Jónatas não acredita nos resultados, tudo bem, mas se quer convencer a platéia, é ele que tem de trazer à mesa as provas do que ele refere. E não basta apregoar, como bem dizes, que o tio Jeremias morreu de perfeita saúde, é necessário trabalho de laboratório a provar que existem problemas sérios na ciência que suporta as teorias existentes.

    Ou seja, o ónus está do lado dele.

    Fico à espera (sentado) pelos estudos científicos que ele tem para provar que centenas de anos de pesquisa da mais alta e precisa ciência que já foi alguma vez feita pelo homem (física) está simplesmente errada.

    ResponderEliminar
  2. Pedro Ferreira04/11/08, 16:00

    Resumindo, a ciência parte da evidência para a verdade e o criacionismo parte da verdade para a evidência.

    A verdade científica é a última etapa: é o esquema explicativo aplicado a muitos casos.

    A evidência é a última etapa para o criacionista: é a tal lacuna que fica por explicar que, segundo estes, é a evidência da sua verdade inicial.

    ResponderEliminar
  3. É a tal treta: os criacionistas têm uma tendência incrível para acreditar nas excepções ou então nas supostas excepções.

    A ciência procura encontrar padrões entre as evidências, observando fenómenos e relações entre fenómenos; a religião arranja supostas excepções (como a santinha a chorar) e procura os aspectos que fogem aos padrões da ciência com uma teimosia que não lembra ao diabo... lol!

    ResponderEliminar
  4. Um excelente post. Simples, conciso quanto e baste e... suficiente para dizer o essencial.

    O grande problema do criacionismo é que ainda não conseguiu interiorizar o que é a imensidão do tempo e o que ela é capaz de fazer ao que existe em cada instante e como o modela e transforma.

    Desprovido dessa capacidade imaginativa, tem de inventar um tempo curto, no qual tudo parece igual ao que sempre foi.

    CL.

    ResponderEliminar
  5. Para o cientista é verdadeiro tudo aquilo que está provado ser verdadeiro. Para o evolucionista é verdadeiro tudo aquilo que ainda não foi provado ser falso.

    A ciência é a mesma, a interpretação é que é diferente. Ao verem um dente na terra, os evolucionistas dizem que aquele dente pertenceu a um ancestral primitivo do ser humano e trata logo de lhe constituir família.

    O evolucionista diz que os animais do passado fizeram coisas que hoje não conseguem fazer.

    Enfim, para ser evolucionista o essencial é ter muita imaginação e muita fé. As licenciaturas são apenas um complemento.

    ResponderEliminar
  6. Pedro Ferreira,
    torna-se óbvio o que escreveste quando dizem que é preciso usar primeiro óculos bíblicos, e depois, sem qualquer capacidade de fazerem previsões, simplesmente adaptam as observações à fé de uma maneira estranha.

    Para a Teoria da Evolução, as aves surgem depois dos répteis. Para os criacionistas bíblicos surgem juntamente com os peixes. A Geo-Física mostrar que os dados estão de acordo com a Teoria da Evolução. Os criacionistas então têm de inventar desculpas: Deus contaminou as amostras espirrando, provocando um dilúvio global, e os animais e as plantas mais inteligentes conseguiram ficar mais tempo sem estarem soterrados. Por exemplo, como as aves são mais estúpidas do que outros animais, elas ficaram para trás, e os corpos de enormes cetáceos - que têm narinas em forma de respiráculo - que não entraram na arca também fossilizaram-se. Como as minhocas não têm narinas, morreram todas. Os sedimentos foram depositados por categorias, segunda uma lei hidraulica divina. E, claro, que os criacionistas nunca testaram essa história, apesar de poder ser testada numa casa-de-banho. É claro que a Ciência não é a mesma!

    Pode ser que haja uma enorme contaminação do caraças, e pode ser que isso tudo seja uma ilusão. Podes ser que eu tenha nascido ontem e tenha uma memória implantada. Pode ser que sejamos visitados por extraterrestres que construiram as pirâmides. Mostrar a descrição da construção das pirâmides e reproduzi-la com sucesso só mostra que só podem ter sido construídas por humanos. Pode ser que a minha tia tenha tomates, e que a minha avó era um extraterrestre. Talvez a minha gata fale ao telefone com outros gatos. Achar que essas tretas são Ciência e que devem dar a volta ao método científico, é como achar que um deficiente mental e motor basta dizer "I'm special!" para poder tornar-se cirurgião sem tirar um curso e provando que é capaz de praticar esse trabalho.

    ResponderEliminar
  7. Mais uma vez Marcos Sabino disse bosta.

    ResponderEliminar
  8. «O evolucionista diz que os animais do passado fizeram coisas que hoje não conseguem fazer.»

    Alguns criacionistas dizem que Adão viveu várias centenas de anos, e que antes o Leão sobrevivia numa dieta de vegetais, e os peixes de água doce sobreviviam na água salgada.

    Por isso os criacionistas são hiper-evolucionistas, acreditam numa mudança muito mais rápida que aqualquer cientista julgaria possível.

    Mas como também têm crenças esquizofrénicas, ao mesmo tempo acusam os cientistas de afirmar que «os animais do passado fizeram coisas que hoje não conseguem fazer».


    Marcos Sabino:

    Uma mutação pode aumentar o tamanho do ADN sem trazer nova informação? Sem alterar a forma como o ser vivo funciona?

    ResponderEliminar
  9. Acho que vou passar a responder a criacionistas com vídeos. Tenho aqui várias "playlists". Por exemplo, na "playlist" sobre Ciência e Tecnologia há um vídeo sobre o Método Científico.

    * Science and Technology
    ** 10 - The Scientific Method Made Easy

    * Evolution

    * On Creationism / ID
    ** 13th Foundational Falsehood of Creationism ("evolution hoax")

    * Creationists

    * Evolution VS Creationism

    É interessante ver que os criacionistas só falam da evolução. E é interessante notar que o Sabino sabido deixa de responder quando nota que disse bosta. O DNA do Neandertal também mostra que era um velho coxo? Deve ter sido também contaminado. Se um criacionista quer deixar de dizer bostas sobre a evolução, deve primeiro saber do que está a falar.

    ResponderEliminar
  10. Ludwig:

    Esta foi certeira. É aqui o cerne da questão.

    CL:

    Sem duvida que esse é um dos problemas que os criacionistas são incapazes de ultrapassar. Lidar com numeros grandes e probabilidades não é para todos. O ser humano tem o habito de fazer estatistica com casos individuais, o que foi util quando vivia na selva, mas nos tempos que correm da nisto.

    ResponderEliminar
  11. Sabido: «O evolucionista diz que os animais do passado fizeram coisas que hoje não conseguem fazer

    João Vasco: «Alguns criacionistas dizem que Adão viveu várias centenas de anos, e que antes o Leão sobrevivia numa dieta de vegetais, e os peixes de água doce sobreviviam na água salgada

    Claro. O Sabido só podia ter sido o sujo a falar do mal-lavado - e sem apresentar exemplos. Aliás, os evolucionistas é que detectam as fraudes e corrigem os próprios erros.

    ResponderEliminar
  12. «Sem duvida que esse é um dos problemas que os criacionistas são incapazes de ultrapassar. Lidar com numeros grandes e probabilidades não é para todos.»

    * RUU #10 - Intelligent Design and Modus Tollens

    * RCR 21 Creationists' Math is Impossibly Stupid

    * Godless Scientists Are Ignorant!

    ResponderEliminar
  13. "O evolucionista diz que os animais do passado fizeram coisas que hoje não conseguem fazer."

    Não é bem assim, para não variar. Acusações de quem deturpa intencionalmente os factos.

    Ha é caracteristicas que representaram uma vantagem numa determinada altura e que deixaram de ser uma vantagem com o tempo. Por exemplo o Tigre dentes de Sabre. Evolui aqueles grandes dentes para caçar presas gigantescas, e foi tão bem sucedido que os dentes não pararam de crescer... Até que as presas grandes acabaram,dizimou-as e aqueles dentes não serviam para mais nada. Realmente até davam pouco geito para comer ratos e coelhos, que se escapavam literalmente entre os dentes. O Tigre dentes de sabre, podia ter sobrevivido se se tivesse espalhado pelo mundo, mas como sabemos não o fez. Quando acabou com a sua comida, foi-se.

    A xita por exemplo segue-lhe as pegadas mas tem o problema oposto. Evoluiu uma grande velocidade de ponta para determinado tipo de presa enquanto se foi tornado relativamente fragil. É uma caçadora exemplar mas não consegue caça grossa. ( que é lenta mas robusta).

    Pensei que era util partilhar esta historia comovente.

    ResponderEliminar
  14. Ludwig diz, os criacionistas respondem:

    “Concordo que devia ser mas parece-me que não é. Parece-me até que para os criacionistas a ciência é precisamente o contrário daquilo que é para os cientistas.”

    A informação codificada no DNA é a mesma para criacionistas e evolucionistas.

    A ausência de evidência de evolução gradual no registo fóssil é a mesma para criacionistas e evolucionistas.

    O facto de os órgãos vestigiais terem, afinal, uma função é o mesmo para criacionistas e evolucionistas.

    “Para um cientista a ciência organiza o conhecimento revelando padrões regulares, correlações e mecanismos que sugerem relações causais.”

    Sim, mas qual teria sido a causa da explosão do Universo a partir do nada?

    De onde vieram a matéria e a energia primordiais?

    Que causa naturalista é que explica a origem de múltiplos códigos paralelos no DNA com a informação mais complexa que se conhece para produzir e reproduzir os organismos mais complexos que se conhecem?

    Diz a experiência que sempre que existe informação codificada, existe inteligência.

    Isso é um padrão regular de causalidade.

    “Para compreender a relação entre o tabaco e o cancro examina grupos de pessoas, estima correlações e testa os efeitos do tabaco em animais.”

    Já muito antes de essa relação ser estabelecida pelos cientistas já as igrejas evangélicas encorajavam os seus membros a não fumar…

    “O tio Jeremias pode ter fumado três maços por dia até aos noventa mas importa mais o padrão que os dados revelam do que as anomalias pontuais.”

    O tio Jeremias não era, com toda a certeza, membro de uma igreja evangélica convencional.

    “O criacionista vê a ciência como uma colecção de anomalias”

    Não existe anomalia nenhuma no facto de não existirem evidência de evolução gradual no registo fóssil, já que isso é inteiramente consistente com o modelo criacionista.

    Isso só é uma anomalia para os evolucionistas.

    Também não existe nenhuma anomalia no facto de as gaivotas só darem gaivotas e não darem crocodilos ou pinguins, visto que os seres vivos se reproduzem de acordo com a sua espécie.

    Também não existe nenhuma anomalia, do ponto de vista criacionista, para a proliferação de fósseis polistráticos e fósseis vivos.

    Isso só é uma anomalia para os evolucionistas.


    “Ignora o enorme conjunto de resultados fiáveis, e o padrão que estes formam, e foca aquela rocha que deu problemas com aquele método ou aquele resultado pontual que não se sabe como surgiu.”

    Sempre que aplicamos os métodos de datação a rochas de idade conhecida apercebemo-nos que eles não são fiáveis.

    O facto de encontrarmos elevados perfis de Carbono 14 em diamantes, rochas, carvão, etc., datados de biliões e milhões de anos mostra que os métodos de datação de isótopos radioactivos estão longe de ser fiáveis.

    De resto, mesmo os evolucionistas admitem isso e corrigem as datas obtidas quando elas não encaixam na sua teoria.

    Assim se explica a proliferação de termos, na literatura geológica, como “Falsos isocrões”, “isocrões aparentes” “pseudo-isocrões”, etc.


    “Enquanto o cientista estuda o cancro o criacionista apregoa, repetidamente, que o tio Jeremias morreu de perfeita saúde.”

    A existência de cancro é um resultado da corrupção espiritual, moral e física que afecta toda a criação desde a queda.

    Ela mostra que as mutações, longe de criarem informação genética nova, destroem a informação genética pré-existente.

    Em todo o caso, Jesus quer dar vida eterna, com um corpo incorruptível, ao Tio Jeremias.

    Mas só se ele aceitar, claro.

    “O cientista procura explicações genéricas que abarquem fenómenos diferentes.”

    É exactamente por causa disso que os criacionistas insistem no facto de que a informação codificada no DNA só pode ter uma origem inteligência.

    É que não se conhece nenhum caso de informação codificada que não tenha tido origem inteligente.

    “A unificação do conhecimento sob esquemas explicativos aplicáveis a muitos casos é um dos objectivos da ciência e uma das suas grandes vitórias.”

    Muito bem. Mas isso não é conseguido dizendo que a vida surgiu por acaso, sem qualquer evidência de que isso tenha acontecido ou de que seja possível.

    “O criacionista não gosta de explicações e prefere explicacinhas.”

    Depende das explicações.

    Contar histórias da carochinha sobre hipotéticos ancestrais comuns ou árvores filogenéticas imaginárias não é uma explicação, porque as mutações não criam informação codificada e não existe qualquer evidência de evolução gradual no registo fóssil.

    “Aqui deus mexericou na radioactividade, ali remexeu a água, acolá deu um empurrão à luz e assim por diante. Cada cor seu sabor.”

    Os criacionistas não inventam milagres por tudo e por nada.

    Eles limita-se a considerar aqueles que Deus disse que fez e que foram testemunhados e registados de forma inteiramente confiável.

    Dizer simplesmente que uma singularidade explodiu do nada ou que a vida suriu por acaso, é invocar milagres que ninguém viu.

    Para isso, mais vale confiar nos milagres registados na Bíblia.

    Francis Crick, no seu livro Life Itself, 1981, 88, disse: “A origem da vida parece ser, neste momento, quase um milagre, tantas são as condições que teria que ter satisfeito para poder avançar"

    Ora, considerando que tem a aparência de um milagre e que tem quantidades inabarcáveis de informação codificada, é inteiramente lógico e racional concluir que a Bíblia tem razão quando diz que foi Deus que criou a vida.

    “O cientista investiga para conhecer e ganhar confiança nas ideias que tem acerca da realidade.”

    Depende de que realidade se trata.

    É que uma coisa é o que se pode observar, outra, completamente diferente é o que se pode inferir a partir de pressuposições indemonstráveis.

    “As hipóteses que formula podem ser verdade mas também podem não ser, e é a evidência que o ajuda a decidir.”

    O facto de nem as mutações nem a selecção natural permitirem criar informação codificadora de novas e mais complexas estruturas é evidência suficiente de que a evolução não aconteceu.

    Se a isso juntarmos a ausência de evidência de evolução gradual no registo fóssil, então temos a certeza de que não aconteceu.

    Se acrescentarmos a evidência de catastrofismo na geologia, então ficamos inteiramente certos de que as rochas e os fósseis descrevem uma catástrofe global, exactamente como a Bíblia ensina e o testemunho de todas as culturas da antiguidade corrobora.


    “Nunca de uma vez por todas mas sempre tentativamente e sempre procurando lugar para melhorias.”

    Entou chegou a altura de uma melhoria substancial que abandone o paradigma evolucionista de uma vez por todas.

    Mesmo os astrónomos já dizem que afinal a evidência mostra que a Terra e o sistema solar são, realmente, únicos e raros. Eles recomendam uma nova revolução coperniciana, de sentido contrário.


    Também isso corrobora o relato da criação.

    “O criacionista só procura lugar onde enfiar os seus milagretes.”

    O evolucionista acredita em milagres sem Deus e nunca observados por ninguém. Só assim se pode dizer que o Universo explodiu do nada por acaso ou que a vida surgiu da não vida.


    O criacionista acredita em milagres com Deus, testemunhados e registados por muitas pessoas.

    Existe evidência histórica muito mais confiável de que o dilúvio existiu e de que Jesus ressuscitou dos mortos do que de que as camadas de sedimentos foram depositadas ao longo de milhões de anos ou de que a vida surgiu por acaso.

    “A verdade, julga ele, já a tem toda, e por isso não lhe interessa um método para a procurar.”

    O facto de já sabermos o que realmente aconteceu, com base em registos de testemunhas oculares, permite-nos desenvolver modelos mais sólidos para tentar compreender o que aconteceu.

    “O que ele precisa é de desculpas para justificar uma crença tão contrária ao que se observa.”

    Nunca ninguém observou a evolução. Para uns, ela é demasiado lenta para ser observada em laboratório.

    Para outros, ela é demasiado rápida para ser observada no registo fóssil.

    Para o geneticista evolucionista Steve Jones ela não pode ser observada nos seres humanos porque já parou (ou nunca começou, diriam os criacionistas).

    Ou seja, a evolução não foi nem pode ser observada.

    O que se observa é inteiramente consistente com o relato bíblico: a vida depende de informação codificada; as gaivotas dão gaivotas, mutações destroem informação, etc.

    “Para o cientista a ciência é uma invenção humana excepcional que ajuda a conhecer o universo, corrigir erros e aproximar-nos da verdade.”

    Não existe nenhuma experiência científica que diga que a ciência é uma invenção humana.

    Na verdade, tendo o Universo sido criado racionalmente por um Deus racional para ser compreendido por seres racionais, porque criados à imagem de Deus, podemos dizer que a ciência foi uma invenção divina.

    “Para o criacionista a ciência é vento no capachinho. Disfarça, diz que segura o cabelo só porque não se quer despentear, mas o desconforto é evidente.”


    Será que homens como Newton, Linneaus, Pasteur, Maxwell, Faraday, Werner von Braun, etc, sentiam algum desconforto? Claro que não!

    Os criacionistas sentem-se totalmente confortáveis com a ciência e com a sua crença em Deus.

    Deus é o supremo cientista, aquele que consegue armazenar informação no DNA conseguindo uma densidade volumétrica de 0.94 x 1021 letras/cm3 e uma densidade informativa estatística de 1.88 x 1021 bits/cm3.

    ResponderEliminar
  15. Jónatas,
    eu não sei se és atrasado, já que já se disse mais de um milhão de vezes para não enviar textos enormes, por isso peço que chames os teus paizinhos para podermos explicar a situação. Ou estás a fingir que és atrasado mental? De qualquer modo, parece ser uma característica comum comum entre os criacionistas.

    ResponderEliminar
  16. "A existência de cancro é um resultado da corrupção espiritual, moral e física que afecta toda a criação desde a queda"

    Não estou de acordo. Os criacionistas falam o Terraplanismo responde:

    A Terra é Plana

    Quero dar conta do ridículo que neste e outros blogues existem defensores ocultos de que a Terra é redonda e de como eles se comportam na sua defesa. Porque:

    1) Recusam aceitar que cientificamente a gravidade puxa as coisas para baixo e não para cima pelo que se prova que se vivesse gente do lado de baixo caia.

    2) Argumentam que a sombra na lua mostra que a Terra é redonda como um esfera e não aceitam os estudos científicos feitos com origami sobre sombras
    que demonstram que a terra é redonda sim, mas plana como a superfície do Mar.

    3) Mostram a sua falta de espírito científico ao deturparem a realidade com aquilo que acreditam só porque nunca andaram de avião. Eu já andei e posso dizer que a Terra é plana até onde a vista chega.

    4) Aceitam a existência de entidades supranumerárias, os satélites, que imagine-se, tiram fotografias que provam que a Terra é redonda. É uma fraude demonstrada pelo facto de que a Terra é realmente plana, como se pode ver ao nível do mar e na forma do horizonte. Que é, espante-se, horizontal.

    5) Ignoram que a Terra redonda teve origem numa conspiração iniciada por Colombo para justificar os seus passeios de barco. Toda a gente sabe que Colombo não chegou à Índia como prometeu.

    6) Basta olhar para um mapa para ver que a Terra é plana. Se fosse redonda tínhamos de ir por baixo do chão para irmos de um ponto distante para outro.

    7) A ciência não explica tudo, tal como demonstrado pela existência de baratas no meu microondas.

    8) Os próprios cientistas não se entendem. Há uns a dizer que a terra é redonda, e outros a dizer que não, que é achatada nos pólos.
    Os polos são iguais para Terraplanistas e criacionistas.

    9) Quase todos os ateus, mais de 90%, acredita que a Terra é redonda, donde se conclui que não só o esfericísmo radical é a causa da actual crise financeira como do nascimento de famosos assassínios em série como Hitler, Ghengis Khan e Estaline.

    10) Para que serve a crença que a Terra surgiu redonda por acaso? Que diferença faz isso nas nossas vidas?

    11) Basta uma única prova de que a Terra é redonda para eu me calar. Uma única. Para dizer a verdade até meia serve, que com o meu espirito critico não dou pela diferença.

    ResponderEliminar
  17. O Jónatas Mental referiu esses assuntos todos num único comentário:

    -------------------------------------

    Orgãos vestigiais:

    * Top 10 Useless Limbs (and Other Vestigial Organs)
    * How Vestigial Organs Work
    * Without the pelvis whales cannot reproduce
    * Vestigial organs may have functions

    ------------------------------------

    DNA:

    * How Evolution Works Part 3- DNA
    * The Origin of the Genetic Code
    * Genome sequencing leaves Creationists unable to respond
    * Evidence for Evolution, Part I
    * What is Junk DNA?
    * genetic evidence planted by SATAN!
    * Life goes on without 'vital' DNA
    * Mice thrive without 'junk DNA'
    * Evidence for Evolution, Part III

    -------------------------------------

    Registo Fóssil:

    * Creationists and Transitional Fossils
    * Creationist Icons: Archaeopteryx
    * Human Evolution: The Evidence
    * Ken Miller Human Chromosome 2 Genome
    * Evolution fish with fingers Transitional fossils
    * Irrefutable Proof of Evolution- Part 1 (mtDNA, ERVs, Fusion)
    * How Evolution Works 6- The Constraints of Evolution
    * Fact of Evolution 1of6
    * Spineless Vermin!
    * Fossil Record
    * AIG Creation Museum refuted by fossils below museum pt.1of 2
    * What Every Creationist Must DENY
    * Re: Satan Invented Evolution Pt 6: Dinosaurs
    * Transitional Fossils

    -------------------------------------

    Big Bang e Física (eu pensei que o deficiente tinha já dito que a energia é eterna... ):

    * Why Young Earth Creationists Must Deny Gravity, Part I
    * Start of big bang theory -LARGE HADRON COLLIDER
    * Life, the Universe and Everything - Excerpt from Session 2
    *
    Order from Chaos

    * Bang para testes!
    * O Universo como um Todo
    * Critical Analysis of Kent Hovind's Garden of Eden
    * Contra VFX: Refuting the Second of the Monkey's Vendetta
    * Explosions such as the Big Bang don't produce order or information
    * Big Bang

    -------------------------------------

    Criacionismo Bíblico:

    * Forgiveness, Grace, and God's Death Sentence
    * Critical Analysis of the Kalam Argument Part 3: Causation
    * God Only SEEMS Nonexistent!
    * Disproving a Creator (God)
    * The Intelligent Dust Bunny
    * MythBusters: Does God exist?
    * God's Cool Designs
    * There was no death or decay before the Fall
    * Life is deteriorating

    -------------------------------------

    Evolução (ninguém observou blah, blah):

    * Micro vs. Macro Evolution
    * Debunking Harun Yahya - Part 1
    * Shaving with Occam's Razor: The Myth of 'Microevolution'
    * 8th Foundational Falsehood of Creationism
    * 11th Foundational Falsehood of Creationism
    * Creation 'Science' Made Easy - 11
    * Why do people laugh at creationists? (part 25)
    * Evolution Genetics Embryo's and our Common Ancestor's
    * HHMI's Evolution - Selection in Action
    * Oliver The Chimp Part 1 of 6
    * What is science and evoltuion?
    * Evolution theory makes predictions
    * Speciation
    * Creationist Skeptics, Evolution and Religion
    * Critical Analysis of Ken Ham's Do Animals Evolve?
    * The Creationist Concept of Kind
    * Macroevolution has never been observed

    -------------------------------------

    Informática e design (Deus é um génio que fez o DNA inferior a computadores. UAU!):

    * Densidade de armazenamento de computador
    * IBM cria sistema com densidade de 1 trilhão de bits
    * Reliability theory disproves intelligent design?(Pt. 1 of 2)
    * There is a law of conservation of information
    * DNA is the result of intelligence because it contains readable information

    ---------------------------------------

    Ou seja, para respondermos ao Jónatas temos de escrever sobre esses assuntos todos. Todo o criacionista é um covarde. No Jónatas transparece em forma de comentários gigantescos.

    ResponderEliminar
  18. Parece que o Ken Ham também tentou fazer vídeos no YouTube: 1. Ken Ham - o herói defensor da Liberdade de Expressão. Ele não deve ter gostado da análise dos seus vídeos.

    ResponderEliminar
  19. Oscar Pereira05/11/08, 00:49

    Caro Jónatas,

    Eis uma pequena citação do seu não-tão-pequeno comentário:

    "É que uma coisa é o que se pode observar, outra, completamente diferente é o que se pode inferir a partir de pressuposições indemonstráveis."

    Tem razão. Pode dizer que a evolução está errada, ou que não explica o aparecimento de informação codificada no DNA (se conseguir justificar tais afirmações). Não pode é dizer que Deus é uma alternativa melhor, pois não há suposição mais indemonstrável do que essa! Se fosse possível demonstrar a existência de Deus, a religião passaria a ser ciência, e não seria preciso ter fé para nada. Se fosse possível demonstrar que Deus não existe, a religião acabaria (e novamente, não se precisaria de fé para nada...).
    Esse parece ser um erro recorrente na sua argumentação (e na do resto dos criacionistas também?). Apontam falhas nas teorias existentes, e propõem Deus como alternativa. Chama-se a isso Deus-das-lacunas, cujo poder diminui com o aumento do conhecimento humano (e cujo fim será portanto, a inexorável extinção).
    Deixo-lhe um exemplo concreto: na Antiguidade, quando se desconheciam as leis que regem os planetas, tais entidades eram frequentemente associadas a deuses. A própria palavra "planeta" etimologicamente significa "errante"! Hoje, muitos séculos e um Isaac Newton depois, ainda pensa nos planetas como "errantes"?

    ResponderEliminar
  20. Oscar Pereira diz, os criacionistas respondem:

    "Pode dizer que a evolução está errada, ou que não explica o aparecimento de informação codificada no DNA (se conseguir justificar tais afirmações)."

    Claro que a evolução está errada. A existência de informação codificada no DNA não pode ser explicada naturalisticamente, porque a informação e um código são uma realidade imaterial

    "Não pode é dizer que Deus é uma alternativa melhor, pois não há suposição mais indemonstrável do que essa!"

    De modo nenhum. A existência de múltiplos códigos paralelos no DNA com informação para codificar triliões e triliões de reacções químicas para serem precisa e sincronizadamente efectuadas para garantir a produção e reprodução de múltiplas espécies é a melhor demonstração possível da existência de um Deus omnisciente (com toda a informação) e omnipotente (com capacidade para armazenar toda essa informação num espaço incrivelmente reduzido).


    "Se fosse possível demonstrar a existência de Deus, a religião passaria a ser ciência, e não seria preciso ter fé para nada."

    Precisamos ter fé em Deus para vermos o óbvio. É por falta de fé em Deus que o Ludwig diz que não existe nenhum código no DNA (quanto todos sabem que existe) e que a Palmira Silva compara cubos de gelo a DNA.

    "Se fosse possível demonstrar que Deus não existe, a religião acabaria (e novamente, não se precisaria de fé para nada...)."


    A verdadeira religião não é cega. Deus é um Deus racional e dá-nos abundante evidência da sua existência. O Universo é a melhor prova da sua existência, já que o Universo teve que ter um princípio e não pode ter sido a sua própria causa.

    "Esse parece ser um erro recorrente na sua argumentação (e na do resto dos criacionistas também?)."

    Não vejo porquê. Se Deus existe, ele pode comunicar connosco sobre a Criação. Se Deus existe é um erro tentar explicar o mundo como se Deus nada tivesse a ver com ele.


    "Apontam falhas nas teorias existentes, e propõem Deus como alternativa."

    Deus é sempre o único caminho, independentemente das teorias humanas. Os criacionistas também constroem os seus modelos que vão alterando em função das observações.

    "Chama-se a isso Deus-das-lacunas, cujo poder diminui com o aumento do conhecimento humano (e cujo fim será portanto, a inexorável extinção)."

    Deus é o criador de tudo o que compreendemos e de tudo o que não compreendemos. Quanto mais conhecemos a natureza, mais compreendemos o poder e a natureza de Deus.

    Se a natureza exprime os atributos de Deus e o seu juizo sobre o pecado humano, como a Bíblia diz, quanto maior for o nosso conhecimento científico tanto maior pode ser o nosso conhecimento de Deus.

    Mas isso só é possível se estivermos dispostos a ver evidência de Deus na natureza.

    "Deixo-lhe um exemplo concreto: na Antiguidade, quando se desconheciam as leis que regem os planetas, tais entidades eram frequentemente associadas a deuses."

    Curiosamente, a Bíblia sempre disse que foi Deus que criou os planetas.


    "A própria palavra "planeta" etimologicamente significa "errante"! Hoje, muitos séculos e um Isaac Newton depois, ainda pensa nos planetas como "errantes"?"

    Newton era criacionista, cujo objectivo era pensar os pensamentos de Deus depois de Deus.

    No mês de Outubro a revista Science et Vie veio dizer que precisamos fazer uma nova revolução coperniciana, de sentido contrário, porque a Terra e o sistema solar são realmente únicos e singulares.

    Na verdade, da leitura de Génesis depreende-se que à Terra coube um lugar especial no plano de Deus e ao observações científicas só confirmam isso.

    Quanto mais estudamos os outros planetas, mais nos apercebemos da singularidade da Terra.

    ResponderEliminar
  21. Oscar Pereira diz que não podemos demonstrar a existência de Deus. No entanto, podemos observar coisas que só são possíveis se Deus existir e se a Bíblia estiver correcta. Vejamos:

    A presença e os efeitos de Deus são perfeitamente detectáveis.

    1. O Universo é um efeito da presença de Deus, já que ele não tem condições para se produzir a si próprio.

    Ele teve um princípio, estando hoje a perder energia e complexidade.

    Por isso, ele necessitou de uma causa que lhe tenha fornecido energia e ordem no princípio, e que não tenha tido ela mesmo um princípio.

    Essa causa só pode ser um Deus todo poderoso, racional e eterno, tal como a Bíblia ensina.

    2. O Universo encontra-se estruturado de acordo com leis físicas, as chamadas leis naturais.

    Por isso, ele pode ser estudado racionalmente.

    A ordem e a racionalidade inerentes ao Universo, juntamente com a sua extrema complexidade, permitem-nos corroborar a racionalidade, a omnisciência e a omnipotência de Deus.

    As leis da natureza são descobertas pelos cientistas, mas foram criadas por Deus. Ele é o legislador.

    3) O Universo encontra-se plenamente sintonizado para a vida, falando os cientistas da existência de centenas de coincidências antrópicas.

    Também isso é inteiramente consistente com a presença e com os efeitos de um Deus vivo que criou o Universo para manifestar a sua glória e para permitir a vida do ser humano criado à sua imagem e semelhança.

    A sintonia do Universo para a vida só é um mistério para quem não conhece o Deus da Bíblia.

    3) O Código de DNA contém informação codificada, especifidando a produção,a reprodução, o funcionamento e a adaptação dos seres vivos, em quantidade e qualidade que transcendem tudo o que o ser humano é capaz de compreender e imitar.

    Não existe informação sem inteligência.

    Não existe código sem inteligência.

    A vida só é possível graças à existência simultânea de informação codificada e do mecanismo necessário para a sua transcrição, tradução e execução.

    A vida é um efeito visível de Deus.

    De resto, não se conhece qualquer explicação naturalista para a origem da vida ou de informação codificada.

    A vida nunca poderia surgir por processos naturalisticos, na medida em que ela necessita de um ingrediente não naturaliistico: informação codificada.

    4) Jesus Cristo, Deus connosco, foi visto por muitas pessoas, as quais presenciaram e registaram os seus milagres e a sua ressurreição.

    Eles registaram que Jesus era todo o poderoso e que a natureza obedecia prontamente às suas ordens.

    Ele curava cegos, ressuscitava mortos, transformava a água em vinho, andava sobre as águas, acalmava as tempestades, etc.

    Isso foi visto e registado, podendo ser investigado historicamente.

    Infelizmente para os evolucionistas, o Big Bang nunca foi observada por ninguém.

    A origem do sistema solar a partir de uma nebulosa tão pouco foi observada.

    A origem casual da vida, também nunca foi observada ou explicada.

    Também o hipotético ancestral comum nunca foi visto ou descrito.


    Também a transformação de uma espécie menos complexa noutra mais complexa também não foi vista.

    Curiosamente, alguns evolucionistas dizem que essa tranformação é demasiado lenta para poder ser observada em laboratório e demasiado rápida para ser observada no registo fóssil.

    O certo é que ela nunca foi nem pode ser observada.


    Tanto basta para mostrar que a teoria da evolução é pura ilusão naturalista.

    ResponderEliminar
  22. O João diz que pretende colocar criacionistas e Terraplanistas no mesmo plano.

    No entanto, devia comparar os Terraplanistas àqueles que insistem em dizer que no DNA não existe qualquer código, quando hoje sabe-se que existem múltiplos códigos paralelos, e com aqueles que comparam cubos de gelo ao DNA.

    ResponderEliminar
  23. Como se lembram, no Rerum Natura a Palmira Silva pretendeu abordar o problema da criação do DNA (e da sua informação codificada) a partir da lei da entropia. Foi aí que fez a infeliz comparação (inadmissível numa professora de química do ensino superior!!) entre cubos de gelo e DNA.


    Eis a resposta criacionista:

    Diante da segunda lei da termodinâmica, os evolucionistas tentam demonstrar que a mesma não constitui obstáculo à evolução.

    Muitos cientistas continuam cépticos dessas tentativas.

    No entanto, como a teoria da evolução é o paradigma dominante, muitos outros preferem não pensar muito no problema ou pensar superficialmente, recorrendo a histórias da carochinha em torno dos sistemas abertos, das probabilidades, da auto-organização, etc.


    Os criacionistas, por seu lado, não têm que tentar compatibilizar a segunda lei da termodinâmica com a sua visão das origens, na medida em que a mesma é um elemento integrante do modelo bíblico que vê a natureza como fisicamente decaída depois da queda.

    Na verdade, a Bíblia refere-se à mesma expressamente, numa linguagem não técnica mas totalmente rigorosa:

    A Bíblia, na Carta aos Hebreus, 1:10-11, afirma:

    “Tu, Senhor, no princípio fundaste a terra, e os céus são obras de tuas mãos; eles perecerão, mas tu permaneces; e todos eles, como roupa, envelhecerão”.

    Em termos simples, para poupar o tempo dos leitores, iremos sumariar o essencial da visão criacionista sobre a segunda lei da termodinâmica e a sua relação com as questões da origem da vida e da evolução.

    Mais informação pode ser encontrada nos sites especializados, como seja www.creationwiki.org


    A entropia pode ser caracterizada como a medida da desordem num determinado sistema.

    Embora se diga que a segunda lei da termodinânica é uma noção estatística, a verdade é que tudo o que sabemos acerca da segunda lei da termodinânica torna extremamente improvável a origem evolutiva das estrelas, das galáxias, dos planetas, do sistema solar a partir da condensação de nuvens gasosas.

    Recorde-se que mesmo astrofísicos como Stephen Hawking, George Ellis, Joseph Silk ou Roger Penrose ainda estão por encontrar uma explicação plausível para a origem acidental das estrelas e das galáxias.

    Isto, para não falar na radical improbabilidade da origem acidental da vida.

    Todos os cientistas, criacionistas ou não, reconhecem que a segunda lei da termodinâmica, ou lei da entropia, pode ser afirmada de várias maneiras.

    Dizer que a entropia no Universo tende para um ponto máximo é o mesmo que dizer que a energia reutilizável, ou transformável me trabalho, tende a diminuir.

    Falar na lei da entropia é dizer que a ordem tende para a desordem.


    Quando a entropia é examinada pela termodinâmica estatística, ela pode ser considerada uma medida da aleatoriedade.

    Quanto mais aleatório é um sistema, tanto mais desordenado ele é.

    Os sistemas desordenados têm um número muito elevado de configurações igualmente prováveis, podendo ser consideradas inevitáveis.

    Entropia não é o mesmo que desordem, mas está logaritmicamente relacionada com a desordem.

    A entropia pode ser considerada como uma medida da desordem.

    A entropia tende naturalmente a aumentar porque os estados desordenados são muito mais prováveis do que os ordenados.

    Acresce que já que os sistemas complexos têm muito poucas configurações igualmente prováveis, eles são extremamente improváveis.

    Na verdade, pode dizer-se que eles são uma impossibilidade estatística.

    Daí que se possa concluir com segurança que um sistema altamente complexo, como a vida, não pode surgir por acaso.

    De resto, tal nunca foi observado, nem conseguido em laboratório mesmo com a inteligência acumulada dos cientistas.


    Do ponto de vista da teoria da informação, diz-se geralmente que a informação tende a deteriorar-se, à medida que o ruído aumenta.

    Uma forma muito simples de falar em entropia é dizer que as roupas tendem a envelhecer, assim como as latas num ferro velho tenderão a enferrujar e não a auto-organizar-se para a produção de novos veículos totalmente eficientes.


    Um sistema isolado não troca energia e matéria com o ambiente circundante.

    O Universo como um todo pode ser considerado como um sistema isolado.

    A entropia total de um sistema isolado nunca diminui.

    O Universo está a perder energia.

    Por exemplo, as estrelas tenderão a apagar-se com o tempo.

    Os criacionistas, entendem que se a qualidade da energia do Universo está a diminuir, isso significa que na origem do Universo havia menos entropia.

    De resto, não são apenas os criacionistas que pensam assim.

    Do mesmo modo, isso significa que o Universo teve um princípio.

    Se o mesmo fosse infinitamente antigo, ele já teria experimentado uma “morte de calor”.

    Ora, se o Universo teve um princípio, ele teve que ter uma causa.

    E ele não pode ter sido a sua própria causa.

    A Bíblia diz que Deus, no princípio, criou o Universo de forma racional e sistemática, isto é, com ordem, ou seja, baixa entropia.

    Também aqui não se vê como é que a segunda lei da termodinâmica poderia ser utilizada para refutar o que a Bíblia ensina.

    Relativamente aos sistemas abertos, os mesmos trocam matéria e energia com o ambiente circundante.

    Muitos evolucionistas têm afirmado que a segunda lei da termodinâmica, ou da entropia, não se aplica aos sistemas abertos.

    No entanto, mesmo muitos não criacionistas chamam a atenção para o facto de que não existem violações conhecidas da segunda lei da termodinâmica.

    De acordo com este entendimento, que está longe de ser um exclusivo dos cientistas criacionistas, a segunda lei da termodinâmica aplica-se a todos os sistemas, sejam eles isolados ou abertos.

    Assim, os sistemas abertos também têm a tendência para a desordem.
    Podem existir casos localizados de redução da entropia, como sejam a formação de cubos de gelo ou cristais, mas a desordem aumenta no sistema aberto globalmente considerado.

    No caso dos cubos de gelo, trata-se de uma realidade termodinamicamente irrelevante quando se trata da origem da vida.

    O processo de congelamento liberta energia para o ambiente envolvente, aumentando a entropia circundante.

    Todavia, a formação de proteínas e ácidos nucleicos a partir de aminoácidos e nucleótidos não apenas reduz a sua entropia, mas remove energia e entropia do ambiente.

    Assim, os aminoácidos os nucleótidos não irão formar espontaneamente ácidos nucleicos ou proteínas em nenhuma temperatura.


    Acresce que os cristais são exemplos de ordem, mas não de complexidade irredutível.

    Esta supõe a convergência simultânea de diferentes partes, de forma especificada, integrada e interdependente, para a realização de uma função inovadora, não possível a partir das partes isoladamente.

    Ou seja, uma coisa é ordem, outra, bem diferente, é complexidade.
    O crescimento de um cristal envolve regularidade.

    Se partirmos um cristal de sal obtemos cristais de sal mais pequenos.

    Diferentemente, se partirmos a molécula de uma proteína biológica (v.g. insulina) não obtemos insulina em quantidades mais reduzidas.

    Deixamos de ter insulina porque destruímos a informação contendo as sequências especificamente codificadoras da insulina.

    A formação de um cristal envolve a assunção, por parte das moléculas, de um padrão pré-determinado, sem qualquer aumento de informação e complexidade.


    No que diz especificamente às máquinas, as mesmas vencem a entropia graças à informação dos engenheiros que as programam, informação essa que dirige a energia de forma precisa e especificada, no sentido de manter ou aumentar a complexidade.

    Mas aí, a redução da entropia necessita de duas coisas.


    A existência de informação, por um lado, e de um sistema de conversão da energia, por outro.

    Na falta destes elementos, a mera existência de energia não garante o aumento da complexidade.


    Os seres vivos adquirem complexidade, durante o seu processo de formação, graças à existência de um código com informação pré-existente (v.g. DNA), contendo as instruções complexas e especificadas para a criação da vida e sistemas altamente precisos de conversão da energia (v.g. fotosíntese, digestão, respiração, circulação sanguínea), também ele codificado no DNA.

    Em todo o caso, esses sistemas não protegem dos raios solares, especialmente quando a camada de ozono, desenhada para nos proteger dos raios ultra-violeta, está a ser destruída!

    Se nos deixarmos estar ao Sol durante muito tempo, o mais provável é ganharmos um cancro na pele, destruindo o nosso corpo e a informação nele contida.

    Uma exposição prolongada ao Sol não irá permitir a aquisição de novas estruturas e funções mais complexas.

    Ela irá causar mutações e estas irão destruir a informação do genoma.

    Na verdade, nem as mutações nem a selecção natural acrescentam informação ao genoma, sendo que a informação só existe significativamente num contexto inteligente.

    O argumento dos sistemas abertos não ajuda a causa da evolução.

    A energia em estado puro é insuficiente, por si só, para criar complexidade especificada.

    Esta depende essencialmente de informação, sendo certo que esta, tanto quanto podemos observar, depende de inteligência.

    Não existe nenhum outro mecanismo naturalista que permita criar informação.

    Por outro lado, se não existirem sistemas complexos de conversão da energia, o fluxo de energia só irá acelerar o processo de entropia.

    No caso, das plantas, por exemplo, não basta energia pura.

    Em primeiro lugar, é necessário uma camada de ozono que filtre a radiação letal e deixe passar a luz solar com a qualidade certa.

    Depois, é necessário que a luz solar atravésse o complexo mecanismo fotosintético, operando sob a direcção do código genético.

    A não ser assim, a luz solar aumenta a desordem, e não a ordem.
    O crescimento de uma planta não é uma excepção ao princípio da entropia, na medida em que ele depende da informação previamente codificada, com todas as instruções necessárias a um crescimento estruturado e funcional.

    A evolução exige processos que aumentem a informação no genoma.

    O crescimento de uma planta, embora dependa inteiramente da informação contida no genoma, não acrescenta informação nova ao genoma.

    O crescimento de uma planta confirma a verdade bíblica de que as plantas se reproduzem de acordo com a sua espécie.

    Hoje sabe-se, de resto, que mesmo a fotosíntese depende, para ocorrer, de um conjunto altamente sintonizado de factores, como sejam o tipo de energia da luz estelar, a atmosfera, a quantidade de vapor de água e as capacidades dos organismos.

    Reduzir toda esta complexidade a um mero “sistema aberto” ou “basta juntar energia” é uma ingenuidade acientífica do maior calibre.

    [Veja-se, John Raven, “Astrobiology: Photosynthesis in watercolours,” Nature, 448, 418 (26 July 2007)]


    Esta sintonia é um facto observável.

    As especulações evolucionistas em torno dos sistemas abertos são pura superstição e têm que ser denunciadas como tais a bem da ciência.

    Os evolucionistas têm uma receita muito simples para a vida e para a evolução: basta juntar água e misturar alguma energia!

    Ah, como seria bom para os evolucionistas se as coisas fossem tão simples!

    O problema é que não são.

    O simples contacto da energia (e da água) com uma hipotética sopa primordial de químicos inorgânicos nunca tenderia a favorecer a auto-organização das moléculas para a vida.

    De resto, tal nunca foi observado.

    Pelo contrário, a energia iria conduzir à destruição dessas moléculas.


    O fabrico de proteínas depende da informação codificada no DNA e de uma maquinaria extremamente complexa de transcrição, tradução e execução das instruções codificadas.


    Na verdade, como podemos ler em Neil Broom, How Blind Is the Watchmaker, 2001, 80,

    “A fundamental problem that science has never been able to solve is how to produce energy flow through the system to do this work of coding in order to produce, for example, a functioning protein.

    Living systems do, of course, harness energy for this purpose, but only because the required, purposefully assembled metabolic machinery is already in place and functioning.”

    O DNA é um livro de instruções, que permite fabricar os mecanismos que irão ler, compreender e executar essas mesmas instruções.

    O mais incrível, é que o DNA nunca poderia subsistir em um complexo sistema de reparação, que tem ele mesmo que ser codificado pelo DNA!


    O ateu convicto Carl Sagan (que agora já percebeu o quanto estava enganado!), dizia que uma célula tem mais informação do que a Biblioteca do Congresso.

    Por seu lado, Richard Dawkins afirmava que o DNA tem mais informação do que toda a Enciclopédia Britânica multiplicada varias vezes.

    Os criacionistas não podem estar mais de acordo!!


    Por seu lado, Bill Gates reconheceu que o DNA é um software mais complexo do que qualquer coisa que o ser humano pode conceber.

    O físico alemão Werner Gitt calculou que uma quantidade de DNA do tamanho de uma cabeça de alfinete contém tantos bits de informação como uma pilha de livros da Terra até à Lua, multiplicada por quinhentos!!


    Se quiséssemos escrever em livro a informação necessária para construir o organismo mais simples que se conhece, necessitaríamos de cerca de mil páginas, de acordo com estimativas geralmente aceites.

    Diferentemente, a informação necessária para construir um ser humano nunca caberia em menos que quinhentos livros de mil páginas.

    E isto, note-se, numa estimativa feita por baixo.

    O recente projecto ENCODE, ao multiplicar exponencialmente a complexidade do genoma, virá certamente a obrigar a uma revisão desta estimativa em alta, para gáudio dos criacionistas.


    É, por isso, pura fantasia, destituída de qualquer comprovação empírica, considerar que tanta informação e que sistemas tão complexos para a sua transcrição e tradução poderiam ter surgido por acaso, ao longo de milhões de anos (que ninguém observou!).

    É mais provável acreditar que um macaco poderia escrever os Lusíadas.

    Mas mesmo que isso fosse possível (o que não acredito), os Lusíadas só seriam reconhecidos como tal se previamente existisse uma convenção de símbolos que permitisse adscrever um significado informativo à respectiva sequência de sinais.

    E isso, quer os evolucionistas gostem quer não, requer sempre inteligência.


    Para quem procura inteligência no Universo, não precisa de ir mais longe.

    O DNA é a expressão, por excelência, de um Deus que se autodefine na Bíblia como LOGOS.

    Os criacionistas partem da Bíblia, que aceitam, pela fé, como Palavra de Deus. Mas a verdade é que a evidência científica encaixa perfeitamente.

    De resto, os cépticos da Bíblia têm visto as suas posições sucessivamente desmentidas pelas mais diversas e fascinantes descobertas arqueológicas.


    Como se vê, não está em causa um conflito entre ciência e religião. O que está em causa é um conflito entre uma visão bíblica do mundo (confirmada pela ciência) e uma visão naturalista do mundo (sistematicamente desmentida pelas observações científicas em si mesmas).

    ResponderEliminar
  24. Oscar Pereira05/11/08, 09:57

    Jónatas,

    Não disponho de tempo para desmembrar a sua argumentação como gostaria (devido ao tamanho [exagerado?] desta última), mas vou apontar uma instância do mesmo erro de raciocínio. Quando diz:

    "A existência de múltiplos códigos paralelos no DNA com informação para codificar triliões e triliões de reacções químicas para serem precisa e sincronizadamente efectuadas para garantir a produção e reprodução de múltiplas espécies é a melhor demonstração possível da existência de um Deus omnisciente (com toda a informação) e omnipotente (com capacidade para armazenar toda essa informação num espaço incrivelmente reduzido). "

    Isto é novamente um exemplo do deus-das-lacunas! Conclui a existência de Deus por considerar insuficiente a explicação das teorias científicas. O problema é que as teorias mudam (quase me apetece dizer que evoluem!) Voltando aos planetas, se tem uma crença de que os planetas são controlados por deuses, e depois aparece uma teoria que explica todos os movimentos dos planetas, para onde é que isso relega a sua crença?
    Religião e ciência não são mutuamente exclusivas. Tomar a religião por ciência contudo, é um erro, que só levará ao extremismo por ambas as partes, com consequências futuras imprevisíveis. Um exemplo é narrado no livro "Inventing the Flat Earth" (pequeno em tamanho, mas grande em conteúdo), do historiador Jeffrey Burton Russel, onde se explica como um extremar de posições causado em parte por interpretações epistemológicas da religião levou ao disseminar do mito (hoje muito comum) de que na Idade Média "toda a gente" pensava que a Terra era plana...
    No debate em Oeiras uma das perguntas que lhe fiz ficou sem reposta, viz. se achava que criacionismo era refutável (condição necessária a todas as teorias ditas científicas), e se esse fosse o caso, e o criacionismo algum dia fosse refutado, o que sobra então para a religião?

    ResponderEliminar
  25. Perspectiva:

    Fico satisfeito por ter recebido a minha mensagem. Fico feliz por saber que o Perspectiva não é um terraplanista. Continue por essa linha de raciocinio e dentro em breve estara maravilhado com a forma como Deus realmente criou a Natureza. O que o Perspectiva falha em compreender é que a ciencia não é mais do que uma admiração incondicional pelo universo. Se Deus criou esse universo Ele decerto aprecia que o admirem.

    O Perspectiva, é obviamente um teologo e na sua area de autoridade, preferia não fazer mais comentarios, mas na minha, nas ciencias da Natureza, a sua incompetencia tresanda, de tal modo que para lhe explicar porquê tinha de lhe ensinar materias desde o ensino primario.

    Se não compreende o Ludwig, a Palmira Silva ou outros é por culpa sua. Não se esta a esforçar o suficiente.

    Em relação ao Criacionismo, é uma fé não cientifica que pretende fazer-se passar por ciencia. Não creio que não tenha consciencia disso. Mas a sua luta acabou, e perdeu. Ha boas razões para acreditar que podemos cantar vitoria sobre o irracional.

    Ha!E prespectiva: 1+1 são 2 e não 3. Quando me citar fora de contexto como faz com o Ludwig e outros, por favor ao menos inclui-a este paragrafo.

    ResponderEliminar
  26. O João Vasco diz que é impossível Adão ter vivido 900 anos. Esquece-se, no entanto, que as condições pre-diluvianas eram bastante diferentes das de hoje. É interessante notar que após o dilúvio, a longevidade das pessoas decresce.

    Com efeito, diz-nos Génesis que a Terra tinha uma camada de água no firmamento (céu):

    " Fez, pois, Deus o firmamento, e separou as águas que estavam debaixo do firmamento das que estavam por cima do firmamento. E assim foi." Génesis 1:7
    "Chamou Deus ao firmamento céu." Génesis 1:8


    Esta protecção pré-diluviana para além de proteger, de forma mais eficiente, a criação de raios UV, IR, etc... aumentaria a pressão atmosférica. Mais oxigénio puro, aumento da esperança média de vida.

    Ainda hoje o recurso a câmaras hiperbáricas clarificam este cenário. Exemplos da menina Jessica McClure, que passou de moribunda a pessoa sã; jogadores da NBA que utilizam estas câmaras para sararem mais rapidamente; animais que crescem mais quando têm mais oxigénio para respirar. Portanto, os factos empíricos, hoje, mostram como as pessoas poderiam viver centenas de anos.

    Mais material sobre isto aqui.

    O João Vasco diz ainda que é absurdo o leão sobreviver numa dieta de vegetais. Deduzo, então, que não conheça exemplos de animais supostamente carnívoros que se alimentam de vegetais. Exemplos da leoa que não comia carne e das piranhas vegetarianas. Portanto, o que o João Vasco diz não poder ter acontecido no passado, hoje vemos que não é preciso um grande esforço mental para acreditar nisso.

    O João Vasco torna a falar na questão dos peixes de água e peixes de água, quando já foi mostrado que essa questão é tão estúpida quanto parece. O Jonatas já falou sobre isso aqui, o Mats já falou sobre isso no blogue dele... Pode ler sobre isso aqui. Com este comentário, o João só mostra que não quer respostas verdadeiras.

    Quanto a tipos de animais transformarem-se noutros tipos de animais, nunca ninguém mostrou um a fazer isso. Os evolucionistas recorrem à táctica de "vender gato por lebre" e mostram gatos pretos a parirem gatos brancos ou borboletas com bolinhas vermelhas a darem origem a borboletas com quadrados azuis, para nos fazerem pensar que a evolução é observada.

    O evolucionista procura confundir as pessoas menos informadas, atribuindo diferentes significados a uma palavra. Exemplo do "aumentar o tamanho do ADN sem trazer nova informação". O João primeiro tem de definir a que se refere por "tamanho", para eu ver se estamos a falar da mesma coisa. Se eu tirar uma cópia do meu BI, aumento o tamanho (quantidade), na medida em que fico com duas cópias do BI, mas não aumento em termos de nova informação.

    Lá dizia Deus: "Obrigo os sábios a recuar e mostro que o seu saber é estupidez” (Isaías 44:25)... Quantas verdades neste versículo!

    ResponderEliminar
  27. Perspectiva,
    eu coloquei referências com ilustrações que refutam claramente o seu apelo à ignorância, o apelo à incredulidade pessoal e falsa dicotomia, que são falácias bem conhecidas. O Óscar apontou o primeiro caso com o Deus das Lacunas - que é uma crítica aos criacionistas inventada pelo evangélico Henry Drummond :
    (The Ascent of Man) «There are reverent minds who ceaselessly scan the fields of Nature and the books of Science in search of gaps — gaps which they will fill up with God. As if God lived in the gaps? What view of Nature or of Truth is theirs whose interest in Science is not in what it can explain but in what it cannot, whose quest is ignorance not knowledge, whose daily dread is that the cloud may lift, and who, as darkness melts from this field or from that, begin to tremble for the place of His abode? What needs altering in such finely jealous souls is at once their view of Nature and of God. Nature is God's writing, and can only tell the truth; God is light, and in Him is no darkness at all.»
    Só porque não consegues imaginar DNA proveniente de reacções químicas (argumento da incredulidade pessoal), isso não torna um bom argumento, especialmente quando se sintetiza DNA.


    * Fallacies list - Appeal to Ignorance
    *
    * Wikipedia - Argument from ignorance - Argument from personal incredulity

    E se repararem bem é um hábito os criacionistas usarem argumentos que claramente descrevem o seu ponto-de-vista, apesar de tentarem aplicá-los aos outros: é o que se chama o sujo a falar do mal-lavado. Além disso como o Jónatas Mendes Machado não consegue responder convenientemente aos contra-argumentos, refugiasse em comentários enormes com assuntos tão díspares, de tal modo que para para respondê-los seria necessário escrever mais do dobro do que escreveu. Isso torna-se mais aparente quando escreve múltiplos comentários gigantescos depois de ter notado que fez asneira. Ou é um palhaço, ou um deficiente mental ou advogado desonesto. E não vejo o Mats a criticá-lo.

    ResponderEliminar
  28. Quando digo: "proteger, de forma mais eficiente, a criação de raios UV, IR, etc...", não me refiro à criação de raios, mas sim proteger a criação de Deus... dos raios.

    ResponderEliminar
  29. Pedro Amaral Couto:

    Acho que alguem lhe devia agradecer o trabalho de pesquisa que esta sempre a disponibilizar.

    Por mim, obrigado.

    ResponderEliminar
  30. Marcos Sabino,

    «Esquece-se, no entanto, que as condições pre-diluvianas eram bastante diferentes das de hoje. É interessante notar que após o dilúvio, a longevidade das pessoas decresce.»

    Não te incomoda a circularidade desta inferência? Tu concluis que a longevidade era maior antes do diluvio porque assumes que a bíblia está correcta. E concluis que a bíblia está correcta porque assumes que a longevidade era mesmo maior antes do dilúvio.

    O problema é que não há nada fora da bíblia que justifique isto. E por justificar eu não quero dizer coisas tais que possas encontrar desculpas para as compatibilizar com a bíblia. Eu quero dizer coisas tais que alguém que desconhecesse a bíblia poderia descobrir a mesma coisa que a bíblia conta examinando os vestígios da geologia, da história, etc.

    Esta é a grande diferença entre os livros de ciência e a bíblia. Só podes saber o que está na bíblia se a leres. Mas a ciência é o produto do estudo da natureza. Podes ter uma boa ideia do que está num livro de química estudando a química em si. Foi assim, afinal, que se descobriu o que escrever no livro.

    Por isso pergunto-te. Se alguém nunca ler a bíblia e nunca ouvir essas histórias dos dilúvios e assim, quais são as coisas na natureza que lhe mostrariam claramente que Adão tinha vivido 900 anos?

    ResponderEliminar
  31. Perspectiva,

    Diante da segunda lei da termodinâmica, os evolucionistas tentam demonstrar que a mesma não constitui obstáculo à evolução.

    Muitos cientistas continuam cépticos dessas tentativas.

    No entanto, como a teoria da evolução é o paradigma dominante, muitos outros preferem não pensar muito no problema ou pensar superficialmente, recorrendo a histórias da carochinha em torno dos sistemas abertos, das probabilidades, da auto-organização, etc.


    Muito pelo contrário. A segunda lei da termodinâmica, que adianto desde já ser mais complexa do que você imagina, é avançada como uma boa razão para o aparecimento da vida. Apesar de a vida ser ordenada, ela acelera a desordem do sistema onde se encontra, não só cumprindo a segunda lei, como sendo até um avanço sobre processos inanimados. O exemplo máximo disto são as acções humanas, que gastam energia a uma velocidade exponencial, dissipando-a em calor. A vida é, entre outras coisas, uma máquina de criação de entropia.

    “Tu, Senhor, no princípio fundaste a terra, e os céus são obras de tuas mãos; eles perecerão, mas tu permaneces; e todos eles, como roupa, envelhecerão”.

    Estamos perante génios, ao nível sem dúvida de Einstein ou de Newton.

    Embora se diga que a segunda lei da termodinânica é uma noção estatística, a verdade é que tudo o que sabemos acerca da segunda lei da termodinânica torna extremamente improvável a origem evolutiva das estrelas, das galáxias, dos planetas, do sistema solar a partir da condensação de nuvens gasosas.

    A probabilidade de eventos passados terem acontecido é de 100%. A sua incapacidade de compreender esta questão semântica e estatística é gritante. Aliás, as estrelas são, como a vida, máquinas de criação de entropia, pelo que a sua existência é vital para o cumprimento da lei referida. No entanto, não basta a 2a lei da termodinâmica para compreender as estrelas, teremos de compreender todas as restantes leis do universo. A gestação de estrelas é bastante simples,

    Isto, para não falar na radical improbabilidade da origem acidental da vida.

    O problema é que tudo o que é desconhecido não é improvável, é apenas desconhecido. O facto de não sabermos exactamente o mecanismo que tornou possível o aparecimento da vida diz menos sobre a natureza do universo do que diz sobre os limites do nosso conhecimento actual. Não se preocupe. Os cientistas estão a trabalhar ferozmente sobre este e muitos outros assuntos.

    Na verdade, pode dizer-se que eles são uma impossibilidade estatística.

    Não existem impossibilidades estatísticas, por definição.

    Daí que se possa concluir com segurança que um sistema altamente complexo, como a vida, não pode surgir por acaso.

    Nem é esse o caso. A vida não surgiu "por acaso", é um resultado de fenómenos naturais, do tempo e das leis do universo. É uma possibilidade que o universo continha nas suas equações, por assim dizer. Tendo em conta a dimensão do universo, diremos que seria isso sim improvável que a vida não aparecesse algures dentro dele.

    Questões de escala, no entanto, já vi que são demasiado complexas para si.

    De resto, tal nunca foi observado, nem conseguido em laboratório mesmo com a inteligência acumulada dos cientistas.

    Já foram conseguidos passos importantes, como a geração das moléculas constituintes da própria vida, apenas por "acaso". A vida demorou milhões de anos a surgir num universo vasto. Digamos que teve muito mais espaço-tempo do que um pequeno laboratório para conduzir a sua "experiência".

    A entropia total de um sistema isolado nunca diminui.

    O Universo está a perder energia.


    Errado. A energia é constante. Reveja os manuais de física elementar. O que acontece é que toda a energia está a ser transformada em calor (dissipação).

    Do mesmo modo, isso significa que o Universo teve um princípio.

    Se o mesmo fosse infinitamente antigo, ele já teria experimentado uma “morte de calor”.


    É uma teoria. Reparo que se agarra ferozmente às teorias que o beneficiam para atacar ferozmente aquelas que o contradizem. Chama-se a isto "idiotice", ou "sonsice", ou simplesmente estupidez. É a minha teoria.

    Ora, se o Universo teve um princípio, ele teve que ter uma causa.

    Aqui falo aos outros comentadores: estão a ver o meu problema com o Modus Ponens? Se A então B? E como se chega a essa conclusão? O que faz com que seja realmente necessário que A, então B?

    É claro como a água que não está minimamente provado que se o Universo teve um princípio, teve de ter uma causa, porque a causalidade acontece dentro e por causa do universo. E nem todos os acontecimentos dependem de uma causa, pois o universo é inerentemente estatístico, logo existe lugar para o total acaso (mecânica quântica).

    Outra razão porque este A logo B referido é errado: a causalidade requer a existência de tempo. Neste caso, a causa aconteceria antes do causado (existência do universo). No entanto, o tempo só existe após a existência do universo, não antes (por isso se chaam de espaço-tempo), pelo que não pode ter ocorrido tempo algum entre a causa e o causado, invalidando a causalidade referida.

    Não tomem este raciocínio como um raciocínio final sobre o assunto. Se for falso, no entanto, demonstra bem a idiotice que é raciocinar através de lógicas "a priori" simplistas sobre questões bem complexas como o nascimento do universo.

    Muitos evolucionistas têm afirmado que a segunda lei da termodinâmica, ou da entropia, não se aplica aos sistemas abertos.

    Aquilo que dizem é que a lei não os confina, não impossibilita a criação de elementos ordenados.

    No entanto, mesmo muitos não criacionistas chamam a atenção para o facto de que não existem violações conhecidas da segunda lei da termodinâmica.

    Jogo de palavras inúteis. Se existissem violações, não seria uma lei física, não é verdade? Parágrafo completamente estúpido.

    ...a segunda lei da termodinâmica aplica-se a todos os sistemas, sejam eles isolados ou abertos.

    Errado. Houve aí um salto de lógica inapropriado. Não existe violação da lei porque ela só se aplica em sistemas fechados. Em sistemas abertos, basta abrir os olhos. Uma árvore é um sistema que se ordenou no seu crescimento. É uma violação clara de uma lei que impede que um sistema aberto diminua a sua entropia. Claro, é uma lei inexistente.

    ...mas a desordem aumenta no sistema aberto globalmente considerado.

    Se é aberto, não é global, se é global não é aberto. Decida-se antes que o seu cérebro entre em colapso mental.

    No caso dos cubos de gelo, trata-se de uma realidade termodinamicamente irrelevante quando se trata da origem da vida.

    É relevante no sentido em que deita o seu raciocínio da impossibilidade da não entropização de um sistema aberto pela pia abaixo.

    Todavia, a formação de proteínas e ácidos nucleicos a partir de aminoácidos e nucleótidos não apenas reduz a sua entropia, mas remove energia e entropia do ambiente.

    Parabéns, acabou de se auto-refutar.

    Acresce que os cristais são exemplos de ordem, mas não de complexidade irredutível.

    Irrelevante e não provado.

    A formação de um cristal envolve a assunção, por parte das moléculas, de um padrão pré-determinado, sem qualquer aumento de informação e complexidade.

    E no entanto, o facto de que se forma é um indício de que poderá tratar-se de um elemento que antecedeu as formas de vida. Nunca se disse que é igual às formas de vida.

    Na falta destes elementos, a mera existência de energia não garante o aumento da complexidade.

    Apenas garante a segunda lei da termodinâmica. De acordo. No entanto, embora o aumento da complexidade não seja obrigatório, não é impossível. E neste universo, tudo o que é possível apenas necessita de tempo para acontecer.

    Os seres vivos adquirem complexidade, durante o seu processo de formação, graças à existência de um código com informação pré-existente (v.g. DNA)

    Irrelevante para o seu discurso.

    Na verdade, nem as mutações nem a selecção natural acrescentam informação ao genoma, sendo que a informação só existe significativamente num contexto inteligente.

    ,logo podemos inferir que a sua incapacidade de ver nas mutações um acrescento de informação é prova da ausência de inteligência que possui? hmmm. Perspectiva interessante!

    O argumento dos sistemas abertos não ajuda a causa da evolução.

    Nem a circularidade e arbitrariedade na sua argumentação ajuda o seu caso.

    Por outro lado, se não existirem sistemas complexos de conversão da energia, o fluxo de energia só irá acelerar o processo de entropia.

    É ao contrário. Os sistemas complexos tendem a gerar mais entropia do que os sistemas simples. Há quem defenda que é devido a isto que a vida existe.

    A evolução exige processos que aumentem a informação no genoma.

    Chamam-se tempo, reprodução e morte.

    O crescimento de uma planta confirma a verdade bíblica de que as plantas se reproduzem de acordo com a sua espécie.

    Génios é o que eu digo! Claro que para essas genialidades o tomate sempre foi tomate e não uma criação genética que o próprio homem concebeu.

    Reduzir toda esta complexidade a um mero “sistema aberto” ou “basta juntar energia” é uma ingenuidade acientífica do maior calibre.

    E no entanto, foi o que você fez. Parabéns. Declarou-se como ingénuo e parvo. Não podia concordar mais.

    O simples contacto da energia (e da água) com uma hipotética sopa primordial de químicos inorgânicos nunca tenderia a favorecer a auto-organização das moléculas para a vida.

    O que dizer perante tamanha teimosia adicionada à estupidez?

    “A fundamental problem that science has never been able to solve is how to produce energy flow through the system to do this work of coding in order to produce, for example, a functioning protein."

    Dado que usa fontes criacionistas, nem confio sequer que o que este senhor diz é verdade, que existem problemas neste nível. Mas, se existem, não seriam novidade, mas antes trabalho para cientistas desenvolverem. Ao contrário de clérigos que apregoam que já sabem como o mundo funciona porque está escrito num livro, a ciência alimenta-se da curiosidade e de problemas para resolver. Aquilo que o perspectiva adianta como tornozelos de Aquiles da Ciência, é, ironicamente, aquilo que a faz tão sólida.

    O ateu convicto Carl Sagan (que agora já percebeu o quanto estava enganado!)

    Iluda-se.

    Por seu lado, Bill Gates reconheceu que o DNA é um software mais complexo do que qualquer coisa que o ser humano pode conceber.

    Também disse que nunca precisaríamos mais do que 640kb num sistema operativo. Bill Gates é um idiota.

    Diferentemente, a informação necessária para construir um ser humano nunca caberia em menos que quinhentos livros de mil páginas.

    E no entanto, quantos DNA não caberiam dentro de um disco rígido de 30 euros? Meu caro, livros são coisas do passado. O futuro é bem mais rico e complexo do que o DNA humano.

    É, por isso, pura fantasia, destituída de qualquer comprovação empírica

    É pura fantasia isso sim sonhar com o facto de que todas as provas empíricas existentes não existem de facto.

    Para quem procura inteligência no Universo, não precisa de ir mais longe.

    Concordo. Chama-se Homo Sapiens.

    O DNA é a expressão, por excelência, de um Deus que se autodefine na Bíblia como LOGOS.

    Meu caro, acredite no que quiser, agora não chame a isso ciência.

    De resto, os cépticos da Bíblia têm visto as suas posições sucessivamente desmentidas pelas mais diversas e fascinantes descobertas arqueológicas.

    Tais como a descoberta dos primeiros homo sapiens com centenas de milhares de anos? A inexistência de um dilúvio? A datação da Terra? A datação do Universo? As incongruências históricas?

    Como se vê, não está em causa um conflito entre ciência e religião. O que está em causa é um conflito entre uma visão bíblica do mundo (confirmada pela ciência) e uma visão naturalista do mundo (sistematicamente desmentida pelas observações científicas em si mesmas).

    O que está em questão é a sua capacidade de ver as coisas exactamente ao contrário do que realmente são.

    ResponderEliminar
  32. Pedro,

    Faço minhas as palavras do João Vasco (até porque eu tenho pouco respeito pelo copyright ;)

    Vou ver se arranjo tempo para compilar o material dos teus comentários num post para a miscelânea criacionista...

    ResponderEliminar
  33. Ludwig, «Tu concluis que a longevidade era maior antes do diluvio porque assumes que a bíblia está correcta. E concluis que a bíblia está correcta porque assumes que a longevidade era mesmo maior antes do dilúvio.»

    Além disso os artigos que ele indicou referem-se não a uma relação entre longevidade e a concentração de oxigénio, mas sim uma terapia através de pressurização do ar através do aumento de concentração do oxigénio («hyperbaric oxygen (oxygen whose pressure or specific gravity is greater than that in the body tissues or fluid)»; mais informação em: Wikipedia, eMedicine, Health Canada, MedicinePlus Encyclopedia ) e o segundo artigo é sobre a relação entre o tamanho e a concentração de oxigénio.

    Na verdade o oxigénio puro é tóxico - na semana passada ainda assisti ao filme "A Esfera" que faz menção disso.
    * Oxygen Toxicity
    * How Stuff Works - Is it harmful to breathe 100-percent oxygen?
    * About.com - Lung diseases - Can Too Much Oxygen Be Harmful?
    * UpToDate for Patients - Oxygen Toxicity

    ResponderEliminar
  34. Existem pessoas que nem comem vegetais: simplesmente alimentam-se do sol. É óbvio de onde o Sabino tirou aquela ideia: The lion that wouldn’t eat meat. Deve ser a mesma parvoíce dos fósseis de gigantes. Vou enviar uma mensagem a http://www.snopes.com/ para investigarem. Se alguém quiser eu mostro a minha gata vegetariana.

    O Jónatas e o Mats são idiotas são formação científica. Não merecem... como é que o Sabino tinha dito... Ah! Não merecem o benefício da dúvida. Basicamente o argumento é de que existem seres que toleram ambos os ambientes ou que mudam consoante o estágio de maturação. Mas não explica - como é suposto, segundo o título - como peixes de um momento para o outro podem sobreviver a um corpo de água que dissolveu praticamente todo o sal do mundo. Se eu colocar peixes de todos os tipos (seja o que isso queira dizer) em tanques separados, que estão dentro de um maior, e depois inundar o maior - simulando o dilúvio - juntando todos os peixes no mesmo corpo de água, o que acontece? Adaptam-se? E depois de recolher a água, adaptam-se em muito menos de 6000 anos?

    Michelson:
    «Existe quantidade enorme de fósseis marinhos. Se realmente eles foram formados da maneira alegada pelos evolucionistas (no decorrer de centenas de milhões de anos), então os fósseis de transição mostrando mudanças graduais de um tipo para outro deveriam ser mais evidentes.»
    * There are no transitional fossils
    * Smooth Change in the Fossil Record
    * Transitional Vertebrate Fossils FAQ

    ResponderEliminar
  35. «Diante da segunda lei da termodinâmica, os evolucionistas tentam demonstrar que a mesma não constitui obstáculo à evolução.»

    * Hovindism #4 Entropy
    * Hovindism #2 1st Law of Thermodynamics
    * Science Notes - Preserving the second law of thermodynamics
    * Thermodynamics for Two, Please
    * Creationism vs Thermodynamics part 1
    * 6th Foundational Falsehood of Creationism
    «Creationists often cite the laws of Thermodynamics as if they could somehow apply to the diversification of life on earth. They don’t. Lord Kelvin, the scientist who discovered those laws was a creationist himself. He was definitely opposed to evolution. But even he said that thermodynamics demands that the earth would still have to be on the order of twenty to forty million years old at least, even if the bowels of the world didn’t continue to heat themselves radioactively, which of course they do, and that pushes the age back much further.»
    * No. 144: THE AGE OF THE EARTH

    Para o tópico em questão:
    Creationists Methodology
    Para rirmos:
    Intelligent Design and Plasticine

    ResponderEliminar
  36. Sabino:

    Em vez de dizeres que não estou interessado na verdade, podias olhar para quilo que tu próprio escreveste.
    Não acreditas que nenhum animal se alterou desde a altura que foi criado? Acreditas que os virus das diferentes doenças sempre foram maus para os seres humanos? Ou foram mutações por causa do pecado original?

    Se acreditas que os seres vivos mudaram, toda a mensagem que me dedicaste perde o seu sentido. Afinal parece que tu é que não estás interessado em conhecer a verdade, mas apenas em divulgar a mentira.

    Por isso, em vez de trocarmos aqui acusações sobre isso, podíamos falar dos assuntos que interessam. Tu podias reconhecer que a acusação que fazes aos evolucionistas (acreditarem que antes os animais podiam fazer coisas que hoje não podem) se aplica ainda mais aos criacinistas, que acreditam que os seres vivos mudaram - e acreditar em vocês, sempre para pior.

    O problema é que vocês acreditam numa coisa e no seu oposto, várias vezes. Acreditam que a Bíblia é para ser interpretada metaforicamente (quando diz que a terra é plana, ou que o Sol anda à volta da terra) ou literalmente (quando diz que o Universo tem poucos milhares de anos), conforme vos dá jeito, etc...

    A última contradição foi a razão pela qual não respondeste à pergunta que te fiz.
    Vocês acreditam em mutações que não acrescentam informação. Isso levar-vos-ia a acreditar em junk DNA - uma mutação que aumente o tamanho do ADN sem acrescentar informação resultaria precisamente em "junk DNA"!.

    E se acreditam em mutações que diminuem a informação, é contraditório não acreditar em mutações que aumentem - para cada mutação existe sempre uma mutação oposta.

    Portanto as contradições são várias. Mas vocês parecem não se importar com isso...

    ResponderEliminar
  37. mama eu quero05/11/08, 15:38

    Parece-me que um dos problemas do Perspectiva é a incapacidade de perceber a escala gigante do tempo e do espaço. É como se tudo fosse do tamanho do seu quintal e do tempo da sua vida.


    Mais:

    "Ele [o Universo] teve um princípio, estando hoje a perder energia e complexidade."

    Está a perder energia? Para onde? Para o Universo do lado esquerdo ou do lado direito?

    E está a perder complexidade? Quer então dizer que está agora menos complexo do que quando 300 mil anos após o início se fez luz e só havia hidrogénio, hélio e fotões?


    Ora explique lá melhor como se eu fosse muito burro. Prometo que tentarei ler até ao fim.

    ResponderEliminar
  38. Pedro Ferreira05/11/08, 16:25

    Descobri algo interessante. No comentário das 11:43, o Marcos Sabino dá uma referência com a explicação de como os peixes de água doce poderiam ter sobrevivido ao Dilúvio.

    Nessa explicação são utilizadas expressões como "os animais marinhos de hoje" ou "existem evidências de especialização pós-diluviana".

    E eu acho isto o máximo... Parece-me que a explicação para a sobrevivência dos peixes de água doce está na evolução e adaptação desses peixes à água salgada.

    Ou seja, a explicação criacionista para a não evolução está... na evolução! :)

    Sou levado a concluir que o universo foi criacionista, houve um período curto onde foi evolucionista (o tempo suficiente para explicar a sobrevivência de algumas espécies ao Dilúvio) e voltou a ser criacionista novamente. Faz lembrar-me um ministro antigo que alterou a lei da SISA num ano, comprou imóveis e depois repôs novamente a lei antiga.

    Quanto a honestidade, acho que fiquei esclarecido. Ou para não ser tão duro, faz lembrar uma rábula do Gato Fedorento

    "- O Mundo é Criacionista!"
    "- Mas como explica o fenómeno X?"
    "- Então, os bichos evoluem..."
    "- Mas isso quer dizer que o mundo é evolucionista"
    "- Não! Foi só um bocadinho, mas depois passou..."
    teoria da evolução

    ResponderEliminar
  39. Para o Perspectiva estudar pela primeira vez Física:

    * e-escola - Conservação da Energia (Básico)

    * e-física - Energia e Trabalho, Conservação de Energia

    * Departamento de Física da UFS -Conceitos básicos de Termodinâmica

    * UOL - Termodinâmica(1) - Calor, trabalho e rendimento

    Que Treta! - Uma Achega - em comentário de "perspectiva":
    «No entanto, importa lembrar que a lei da conservação da energia, de acordo com a qual a energia não surge do nada nem pode ser destruída, diz-nos que a energia não pode ter sido responsável pela sua própria criação.

    A energia permanece constante, apesar de mudar de forma e de poder ser transferida de um corpo para o outro.»

    "Perspectiva" comentado aqui:
    «O Universo é um efeito da presença de Deus, já que ele não tem condições para se produzir a si próprio.

    Ele teve um princípio, estando hoje a perder energia e complexidade.» (...)
    «Um sistema isolado não troca energia e matéria com o ambiente circundante. O Universo como um todo pode ser considerado como um sistema isolado. A entropia total de um sistema isolado nunca diminui. O Universo está a perder energia. Por exemplo, as estrelas tenderão a apagar-se com o tempo.»

    Então a energia é constante e está a perder-se. Ou muda consoante argumentos de advogado. Mas o mais interessante é a energia perder-se num sistema isolado - contradizendo a primeira lei da termodinâmica. Boa, Mike!

    ResponderEliminar
  40. Pedro Ferreira05/11/08, 16:39

    Pedro Amaral Couto,~

    "Excelente, Melga!"

    ResponderEliminar
  41. Pedro Ferreira,
    «Ou seja, a explicação criacionista para a não evolução está... na evolução! :)»

    Não é meramente uma evolução - é uma evolução instantânea, ou pelo menos menos de 40 dias. É como colocar pinguins do Antártico no quente deserto do Saara - não num gradual aumento de calor, permitindo ocorrer selecção natural - e espera que haja logo uma população de pinguins adaptados ao calor. Isso é evolução do outro mundo.

    ResponderEliminar
  42. Pedros,
    vocês não entendem!!!
    A evolução instantânea só corroba a intervenção de Deus

    ResponderEliminar
  43. Pedro Ferreira05/11/08, 17:05

    Pedro,

    Tens razão. no entanto, eu acho que a agonia que um peixe de água doce passa na água salgada deverá ser mais similar a uma apneia.

    Logo a tua analogia só peca por defeito. Seria mais apropriada a seguinte analogia: um humano conseguir fazer uma apneia durante todo o mês de Janeiro, porque desenvolveu umas guelras durante a festa de fim-de-ano... :D

    ResponderEliminar
  44. "O João Vasco diz que é impossível Adão ter vivido 900 anos. Esquece-se, no entanto, que as condições pre-diluvianas eram bastante diferentes das de hoje. É interessante notar que após o dilúvio, a longevidade das pessoas decresce"

    eu tenho uma teoria melhor. Eles não sabiam contar.

    ResponderEliminar
  45. mama eu quero06/11/08, 01:00

    Perspectiva,

    O mama eu quero perguntou... pensava que os criacionistas respondiam...

    Estou à espera e muito curioso com a resposta.

    Já agora... em 6000 anos não se deve ter "perdido" muita energia nem muita complexidade. Certo?

    Tudo porque o desobediente do Adão papou a maçã? Ah... maroto esse Adão! Fosse o Perspectiva o primeiro não estávamos a "perder energia e complexidade". Ingénuo esse Adão.

    :)

    ResponderEliminar
  46. Piscar de olho na Gulbenkian
    Não sei se havia muitos criacionistas entre a audiência que encheu os auditórios da Gulbenkian ontem à tarde. Mas se não havia, é pena! Foi um gosto ouvir o prof. Feijó (FCUL) desancar a demagogia criacionista apoiada no milionário Discovery Institute, a propósito do lançamento do livro "Evolução: História e Argumentos" (Esfera do Caos). No fim aconselhou (a paródia) "Flock of Dodos" (Randy Olson) - acessível via YouTube.
    A seguir foi também um prazer ouvir a jovem investigadora Patrícia Beldade falar sobre "Evo-Devo" e borboletas. Pena uns pequenos deslizes em que usou as palavras... criar ou criação!!
    Álvaro Fonseca

    ResponderEliminar
  47. Pedro Amaral Couto diz:

    "Então a energia é constante e está a perder-se. Ou muda consoante argumentos de advogado."

    A energia permanece constante, no sentido de que não desaparece. (lei da conservação da energia)

    Mas a parte dela que se pode transformar em trabalho vai diminuindo. (lei da entropia)

    Isso é reconhecido por todos os físicos.

    ResponderEliminar
  48. Mas a parte dela que se pode transformar em trabalho vai diminuindo. (lei da entropia)

    Este comentário é tão ignorante! A "parte dela" que se "transforma" em "trabalho"?!?

    Mesmo que fosse verdade que a energia se "transformasse" em trabalho, essa não é a fase de que a 2a lei da termodinâmica se refere, mas antes a dissipação em calor, estado final da energia (e não, como se subentende no seu comentário, um estado "à parte" do estado de energia).

    Isto sim, se pode dizer que todos os cientistas concordam.

    ResponderEliminar
  49. Tenho comentado aqui várias vezes sob o pseudónimo que é uma regra algébrica da multiplicação.
    Decidi que está na altura de me apresentar com o meu verdadeiro nome.

    Perspectiva,

    continue assim com comentários curtos e sucintos e poderá ter a certeza que vai captar a atenção dos seus interlocutores.

    "Mas a parte dela que se pode transformar em trabalho vai diminuindo. (lei da entropia)"

    É verdade mas isso também significa que o universo se vai tornando mais complexo e que, portanto, contém mais informação.

    Ao contrário da energia, não existe nenhuma lei da conservação da informação. Antes pelo contrário a informação comporta-se naturalmente como a entropia : aumenta sempre.

    ResponderEliminar
  50. PAC,

    obrigado pelos teus links.

    Quando citas o perspectiva repara igualmente na frase:

    A entropia total de um sistema isolado nunca diminui.

    O que também contradiz a segunda lei da termodinâmica. O Jónatas não é autista, pois os autistas não sofrem, em princípio, de inconsistência. No entanto, esta característica abunda no criacionismo.

    ResponderEliminar
  51. Barba Rija,
    à parte a falta de rigor com que o perspectiva enunciou a "lei da entropia" o sentido da afirmação é correcto: a exergia ou energia disponivel para ser usada diminui à medida que o sistema tende para o equilibrio térmico

    ResponderEliminar
  52. Ludwig,

    É você quem está a imaginar a circularidade da minha afirmação. Eu não concluo que a bíblia está correcta pelo facto de as pessoas viveram mais anos antes do dilúvio. Quanto muito assumo a 1ª - de a longevidade ser maior antes do dilúvio porque assumo que a bíblia está correcta. Eu também posso criar circularidades evolucionistas do tipo "a selecção natural diz que os mais aptos vão sobreviver e eu sei que eles são os mais aptos uma vez que sobreviveram".

    Toda a gente parte das suas pressuposições. Os criacionistas partem da bíblia, portanto, vão olhar para o ambiente tendo em conta os relatos bíblicos. Os evolucioniostas partem do naturalismo e vão olhar o ambiente de acordo com essa visão. Há coisas fora da bíblia que justifiquem os homens terem vivido centenas de anos. Como já mostrei, o recurso a câmaras hiperbáricas, onde a pressão atmosférica é dobrada, mostra que as pessoas curam-se mais depressa, as plantações crescem mais, os animais crescem mais e vivem mais... esse era o estado pre-diluviano.

    Você pergunta-me "Se alguém nunca ler a bíblia e nunca ouvir essas histórias dos dilúvios e assim, quais são as coisas na natureza que lhe mostrariam claramente que Adão tinha vivido 900 anos?"... ora, se alguém não ler a bíblia nem vai saber que as pessoas viviam centenas de anos.

    ResponderEliminar
  53. A terra NÃO é um sistema isolado. Por isso, a entropia poderia diminuir na terra e não haveria qualquer violação de nenhuma lei da termodinâmica.

    Quando será que os criacionistas acordam para esta verdade tão simples?

    ResponderEliminar
  54. Sabino:

    Novamente pareces não ter conseguido responder-me...

    ResponderEliminar
  55. O João Vasco está muito confuso em relação àquilo que os criacionistas dizem.

    1) Não acreditas que nenhum animal se alterou desde a altura que foi criado?
    R: Os criacionistas acreditam que os animais se vão reproduzir de acordo com o seu tipo.

    2) Acreditas que os virus das diferentes doenças sempre foram maus para os seres humanos? Ou foram mutações por causa do pecado original?
    R: Doenças, pestes, morte... é o resultado da desobediência de Adão. No mundo que Deus criou não havia nada disso. "junk-dna", mutações destrutivas e estruturas danificadas são coisas que encaixam lindamente num mundo decaído em resultado do pecado.

    O problema é que o João Vasco considera que os animais mudarem (entenda-se, variarem dentro do pool genético) é evidência para evolução de peixes para pescadores. Acredita que a especialização dos vírus e bactérias é evidência de evolução de bactérias para médicos (apesar de as bactérias nunca deixarem de ser bactérias).

    Os criacionistas não acreditam numa coisa e no seu oposto, o evolucionista é que faz confusão com os termos utilizados. A razão pela qual eu pedi ao João Vasco para definir "tamanho" reside no facto de eu saber que os evolucionistas estão sempre a tentar "vender gato por lebre". Quem acredita numa coisa e no seu oposto são os evolucionistas, já que a teoria acomoda comportamentos mutuamente exclusivos.

    O João Vasco diz que interpretamos a bíblia "conforme nos dá jeito", o que é uma boa mentira. Nós interpretamos a bíblia de acordo com o genero literário em questão. E tal como nas aulas de português que o João frequentou, teve de analisar os textos de acordo com a narrativa, os criacionistas também fazem o mesmo. Mas isto é algo que o João Vasco não vai entender em relação à bíblia, já que não lhe interessa.

    ResponderEliminar
  56. Ou seja Sabino, como eu te disse no teu blog, essa é a tua interpretação da bíblia. Não tem nada de objectivo.É a tua interpretação. E já agora, podes responder tb aqui:

    Como defines o tal "tipo" de acordo com o qual os animais se reproduzem?!

    Parece-me que esta questão é bastante central.

    ResponderEliminar
  57. Sabino:

    Voltaste a não responder à pergunta que te fiz já duas vezes.


    Mas foi interessante ler isto:

    «Doenças, pestes, morte... é o resultado da desobediência de Adão. No mundo que Deus criou não havia nada disso. "junk-dna", mutações destrutivas e estruturas danificadas são coisas que encaixam lindamente num mundo decaído em resultado do pecado.»



    Antes tinhas dito:

    «O evolucionista diz que os animais do passado fizeram coisas que hoje não conseguem fazer.»

    E quando eu dei exemplos de como o cricionismo faz o mesmo, rejeitaste todos e disseste que eu não queria saber da verdade. Mas pelos vistos és TU que confirmas o que eu disse. Que as mutações destrutivas fizeram isso mesmo.


    Mas gostei particularmente que falasses no "junk DNA". É que tu dizes que isso encaixa na visão criacionista - o que concordo. Na verdade era complicado acreditar em mutações que aumentam o tamanho do ADN e não trazem nova informação e não acreditar em "junk DNA" que seria resultado destas. Mas isso quer dizer que acreditas que o "junk DNA" existe, certo?

    ResponderEliminar
  58. "Há coisas fora da bíblia que justifiquem os homens terem vivido centenas de anos. Como já mostrei, o recurso a câmaras hiperbáricas, onde a pressão atmosférica é dobrada, mostra que as pessoas curam-se mais depressa, as plantações crescem mais, os animais crescem mais e vivem mais... esse era o estado pre-diluviano."

    Isto é delicioso! Então essa "alma penada" não sabe que os tratamentos hiperbáricos devem ser de duração curta por forma a evitar a toxicidade do oxigénio.

    Sobre a confusão que anda na cabeça do perpectiva & companhia sobre a 2ª lei da termodinâmica o Ludwig escreveu este post interessantissimo que encerra completamente a discussão, só que os criaccionistas só assimilam aquilo que lhes convém.

    ResponderEliminar
  59. «O problema é que o João Vasco considera que os animais mudarem (entenda-se, variarem dentro do pool genético) é evidência para evolução de peixes para pescadores. Acredita que a especialização dos vírus e bactérias é evidência de evolução de bactérias para médicos (apesar de as bactérias nunca deixarem de ser bactérias).»

    Sabino:
    A única coisa que acreditamos de diferente é que as mutações podem trazer nova informação.
    Tu dizes que acreditas na selecção natural, suponho que acredites na hereditariedade, e acreditas que as mutações alteram o material genético.
    Com isto tudo, se acreditares que as mutações podem criar informação nova ENTÃO como consequência daquilo que acreditas terias de achar muito natural que ao longo de milhões de anos aos seres vivos evoluissem para ficarem muito diferentes daquilo que eram.

    Portanto sempre que dizes: "vocês acreditam que um dinossauro pode dar uma galinha", é equivalente a dizeres "vocês acreditam que as mutações podem trazer nova informação".

    Espero que percebas isto: se tu acreditasses que as mutações podem trazer nova informação, seria natural que em vários milhares de anos os seres vivos fossem mudando bastante. Pode dizer isso porque "parece rídiculo", mas a ciência diz-nos coisas que parecem muito mais ridículas: diz-nos que mesmo quando estás parado a terra está a fazer-te deslocar a vários km/h, diz-nos que se andares perto da velocidade da luz o tempo fica mais lento, tu ficas mais fininho e pesado. E que tendo dois eventos simultâneos para um observador parado, um deles pode ser anterior para um observador com determinada velocidade, e posterior para outro com outra velocidade. Isto é teoria da relatividade restrita. Não tem nada contra o criacionismo (por isso pode aceitar), e no entanto rejeita completamente o senso comum.

    Só que não faz sentido acreditar que as mutações não podem trazer nova informação, porque isso já foi visto.
    O Ludwig escreveu um texto em que descrevia uma mutação em concreto que trazia nova informação. Mas sobre isso vocês não querem falar, por isso é que não respondeste à minha pergunta.


    «Nós interpretamos a bíblia de acordo com o genero literário em questão.»

    Não.
    Interpretam a Bíblia conforme vos dá jeito. Antes dos cientistas descobrirem que a terra andava à volta do Sol, e mesmo pouco depois de terem provas, os cristãos ainda recusavam aquilo que os cientistas diziam.
    Nessa altura, pareciam tão literais os trechos que falavam numa coisa como noutra.
    Só anos mais tarde é que os cristãos foram começando a reparar que a única maneira da Bíblia ser levada a sério era se dessem a desculpa de que o que lá estava sobre o Sol andar à volta da terra ser "poético/metafórico".
    Tu dizes que isso é bastante óbvio, mas não foi para quase nenhum cristão durante centenas de anos.
    Tu dizes que isso é bastante óbvio, mas muitos cristãos dizem que também é óbvio que o Genesis está escrito na mesma linguagem, e deve ser interpretado da mesma forma não-literal.

    Por isso a tua interpretação é apenas uma conveniência para encaixar nos preconceitos criacionistas.

    ResponderEliminar
  60. Sabido:

    «R: Os criacionistas acreditam que os animais se vão reproduzir de acordo com o seu tipo.»
    O que é um tipo?

    «R: Doenças, pestes, morte... é o resultado da desobediência de Adão.»
    Enfia a Bíblia no rabinho - aposto que deves gostar disso. Imagina que ela nunca existiu. Como é que provas isso? Vais recorrer a outros livros sagrados?
    É claro que o que os vírus e bactérias fazem para provocar doenças não é complexo e especializado, por isso não foram desenhados - é bom ver como os criacionistas são coerentes.

    O problema do Sabido é que inventa factos e nem sequer sabe o que está a dizer (nem deve saber o que é um "tipo").

    ResponderEliminar
  61. João Vasco,
    o Sabino não vai responder porque ele sabe muitíssimo bem que não pode responder, porque reparou muito bem na contradição. Fica aqui registado que enquanto ele não responder até próxima quinta-feira, assume-se que ele admite que existe essa contradição no Design Inteligente. Se assim não for, então hortaliças não são vegetais.

    ResponderEliminar
  62. Marcos Sabino,

    «Quanto muito assumo a 1ª - de a longevidade ser maior antes do dilúvio porque assumo que a bíblia está correcta.»

    Mas porque é que assumes que a bíblia está correcta? Simplesmente porque assumes verdadeiro tudo o que a bíblia diz. Isso ou é um argumento circular, se considerares que são duas proposições diferentes, ou é uma premissa injustificada. Seja como for, é sim porque sim. E isso é treta.

    «Eu também posso criar circularidades evolucionistas do tipo "a selecção natural diz que os mais aptos vão sobreviver e eu sei que eles são os mais aptos uma vez que sobreviveram".»

    Isso é uma definição, não uma proposição. Define-se aptidão como sendo o sucesso reprodutivo a longo prazo (e não a sobrevivência). Daí deriva-se que em certas condições (hereditariedade, reprodução diferenciada em função das características herdadas, etc) certas características vão tender a espalhar-se pela população.

    É deste modelo que se inferem previsões (não só qualitativas mas também quantitativas) que permitem pôr o modelo à prova confrontando-o com os factos e é finalmente isso que nos leva a confiar no modelo.

    «Toda a gente parte das suas pressuposições.»

    Não. Toda a gente parte de pressuposições, mas não precisa de as considerar como suas. Além disso, uma coisa é partir de um pressuposto, testá-lo e confiar nele apenas na medida em que passa pelos testes com melhor desempenho que outros pressupostos. Outra bem diferente é partir de um pressuposto e não ir a mais lado nenhum, ficando agarrado ao pressuposto só por ser o "seu".

    Em ciência segue-se o primeiro caminho. É por isso que temos que mudar os pressupostos regularmente, conforme as evidências. Tu não segues caminho nenhum. Ficas-te pelo pressuposto. É isso que eu critico.

    Que testes sugeres que se faça aos modelos que a bíblia propõe? Que evidências tens que suportem a hipótese que Adão viveu 900 anos? Se é só o pressuposto espero que já tenhas percebido que isso não vale nada. Como dizia o outro, pressupostos há muitos...

    ResponderEliminar
  63. Marcos Sabino: oxigénio puro é tóxico - hiperoxia - afectando os pulmões, os olhos e sistema nervoso central. Se respirares oxigénio puro durante mais de 16 horas, simplesmente morres. É assim que Adão viveu, ò cromo! No filme que referi uns cientistas entraram numa câmara de pressurização (ou hiperbárica) onde o oxigénio era misturado com hélio, explicando que o oxigénio puro é tóxico.

    Jornal Online de Biociências:
    «Excepto aqueles organismos que estão especialmente adaptados para viver em condições anaeróbias, todos os animais e plantas requerem oxigénio para eficaz produção de energia. Cerca de 95% de energia metabólica é produzida nas mitocôndrias. Se essa reacção é bloqueada perdemos consciência e morremos muito rapidamente.

    No entanto sabe-se há já muito tempo que grandes concentrações de oxigénio se tornam tóxicas para plantas e animais. O oxigénio é tido como factor de aumento dos efeitos do dano da radiação ionizante, nas células vivas. É preciso três vezes menos radiação para matar uma célula numa atmosfera de oxigénio, em comparação com uma atmosfera de nitrogénio. Os efeitos do dano do oxigénio afectam quase todos os tecidos que constituem um organismo, embora o dano em si dependa da espécie, do tecido estudado, das condições fisiológicas, da idade e da dieta do organismo.

    Ironicamente, a molécula da qual dependemos para a nossa vida também contribui para a nossa morte.

    Das várias explicações apresentadas para explicar a toxicidade do oxigénio a mais divulgada e largamente aceite descreve os efeitos do oxigénio a nível de dano celular como causado por radicais livres. Estas moléculas são induzidas a formar na presença de oxigénio e estão implicadas em mais de sessenta disfunções, tal como doenças cardíacas, cancro e cataratas. Também parecem ser um dos principais factores responsáveis por mudanças corporais características da idade e da senescência

    As câmaras hiperbáricas aumentam a pressão do ar, ò anormal! Eu até indiquei sites a explicar o que são. Se em vez de os criacionistas limitarem-se a ler sites criacionitas e procurarem informarem-se por onde são realizados os trabalhos em questão (como os hospitais com câmaras hiperbáricas), evitariam figuras de palhaços.

    ResponderEliminar
  64. Pedro Ferreira06/11/08, 14:16

    PAC,

    Acho o teu esforço louvável, mas estás a perder o teu tempo.

    Se o que o Sabino disse sobre as câmaras hiperbáricas fizesse sequer o mínimo sentido, pelo menos gente com poder de compra suficiente, viveria SEMPRE em ambientes hiperbáricos.

    ResponderEliminar
  65. Pedro Ferreira06/11/08, 14:21

    PAC,

    Para completar... Quem vive em ambientes despressurizados, como as hospedeiras e os pilotos de avião, tenderá a viver menos, certo?

    Seria então um acto moralmente correcto obrigar cada companhia aérea a oferecer, por cada hora de vôo, o mesmo tempo numa câmara hiperbárica, para compensar o tempo de vida retirado...

    Bem, isto há cada uma...

    ResponderEliminar
  66. Eu tenho aqui na minha mão um livro da "Origem das Espécies" traduzida por Joaquim Dá Mesquita Paul (médico e professor), editado por Lello & Irmão (Porto). O capítulo IV tem o título "A selecção natural ou a persistência do mais apto":
    «O homem não pode produzir nem impedir variaçõs; pode apenas conservar e acumular as que se lhe apresentam.» (...)
    «Há razão pata admirações, quando vemos que variações úteis ao homem são certamente produzidas, que outras variações, úteis ao animal na grande e terrível batalha da vida, se produziram no decorrer de numerosas gerações? Se se admite este facto, poderemos duvidar (e preciso lembrar que nascem mais indivíduos do que aqueles que podem viver) que os indivíduos possuindo uma vantagem qualquer, por mais ligeira que seja, tenham probabilidade de viver e de reproduzir-se? Podemos estar certos, por outro lado, que toda a variação, por menos nociva que seja ao indivíduo, traz forçosamente a desaparição deste. Dei o nome de "selecção natural" ou de "persistência do mais apto" à conservação das diferenças e das variações individuais favoráveis e à eliminação das nocivas. As variações insignificantes, isto é, que não são nem úteis nem nocivas ao indivíduo, não são certamente afectadas pela selecção natural e permanecem no estado de elementos variáveis, como as que podemos observar em certas espécies polimorfas, ou terminando por se fixar, graças à natureza do organismo e às das condições de existência.
    Muitos escritores têm compreendido mal, ou criticado mal, este termo de "selecção natural". Uns têm mesmo imaginado que a selecção natural traz a variabilidade, visto que envolve somente a conservação das variações acidentalmente produzidas, quando são vantajosas ao indivíduo nas condições de existência em que se encontra colocado.» (...)
    «Compreenderemos melhor a aplicação da lei da selecção natural tomando para exemplo um país submetido a quaisquer ligeiras alterações físicas, uma alteração climatérica, por exemplo.» (...)
    «Neste caso, ligeiras modificações, favoráveis em qualquer grau que seja aos indivíduos de uma espécie, adaptando-as melhor a novas condições ambientais, tenderiam a perpetuar-se, e a selecção natural teria assim materiais disponíveis para começar a sua obra de aperfeiçoamento»

    Nas AnswersInGenesis, Arguments we think creationists should NOT use:
    «“Natural selection is a tautology.”

    Natural selection is in one sense a tautology. Who are the fittest? Those who survive and leave the most offspring. Who survive and leave the most offspring? The fittest. But a lot of this is semantic wordplay, and depends on how the matter is defined, and for what purpose the definition is raised. There are many areas of life in which circularity and truth go hand in hand. For example, what is electric charge? That quality of matter on which an electric field acts. What is an electric field? A region in space that exerts a force on electric charge. But no one would claim that the theory of electricity is thereby invalid and can’t explain how motors work; it is only that circularity cannot be used as independent proof of something. To harp on the issue of tautology can become misleading, if the impression is given that something tautological therefore doesn’t happen.» (...)

    ResponderEliminar
  67. mama eu quero06/11/08, 14:34

    "Mas a parte dela que se pode transformar em trabalho vai diminuindo."

    Sim se o sistema tender para o equilibrio térmico.


    Mas isso só irá acontecer daqui a umas dezenas de milhares de milhões de anos se a aceleração da expansão se mostrar correcta. Se não se mostrar correcta então só daqui a centenas de milhar de milhões ou milhões de milhões de anos quando o espaço estiver tão "esticado" que impedirá qualquer interacção das forças conhecidas (e aqui há quem diga que poderão estar reunias as condições para outro BANG... ao estilo do "rasgar" do espaço tempo - a causa - novo pocket universe - sim, sim, é viajar na maionese mas é assim que tem de ser).

    .....


    Afinal o "sistema" ja teve em quase total equilibrio térmico no início. A "foto" da radiação de fundo quando se fez luz mostra isso mesmo (para quem só acredita vendo e não raciocinando). E a gravidade veio desequilibrar isso tudo. Portanto dizer que tende para a "perda" de energia (tender para o equilibrio térmico) é redutor e só válido no final dos tempos.

    A verdade é que, no limite, tende para os zero graus absolutos mas isso só irá acontecer no infinito do tempo e quando o espaço tiver dimensão infinita.

    "Está a perder energia" é uma treta.



    E todas estas afirmações têm de ser feitas com cautela, muita cautela. Não sabemos assim tanto mas estamos prestes a dar outro salto em frente no conhecimento. E não fazemos idéia do entendimento que poderá sair destas novas experiências:

    Ver aqui.

    Pena o LHC ter avariado. Cheira-me que estão a ser criadas condições para um BUMMM de teorias mais completas sobre estas coisas como houve no inicio do século passado.

    ResponderEliminar
  68. mama eu quero06/11/08, 14:54

    Comentário do Jonatas no De Rerum Natura:

    "Apesar de algumas mutações terem efeitos benéficos, as moscas dão sempre moscas."

    Beeeemmmm!

    Isto é que são progressos.

    Já admite mutações genéticas com efeitos benéficos!

    Mas ainda está à espera de ver uma mutação que faça uma mosca transformar-se numa minhoca...

    ResponderEliminar
  69. Pedro Ferreira,
    pergunta também a quem vive em montanhas.
    Longevidade dos habitantes da Sardenha intriga cientistas
    «Nas montanhas da Sardenha, uma ilha a 190 quilômetros da costa italiana, um mistério intriga os cientistas: a vida longa - muito longa - dos seus habitantes. Aos 98 anos, Silvia Piras lê os jornais sem a ajuda de óculos. O marido, Efisio, já completou 100 anos e ainda cuida de plantas.»

    Health and Old Age Places with High Longevity: Transcaucasia Part 1
    «Location. The Soviet Union's southernmost point is dramatized--and dominated--by the Caucasus, a 750-mi.-long strip of mountains with peaks such as Mount Kazbek, the Dykh-Tau, and Mount Elbrus rising magisterially to more than 16,000', 17,000', and 18,000' respectively. The Caucasian mountains run between 2 great lakes called "seas": to the west the Black; to the East, the Caspian.» (...) «Longevity. The total population of the area is about that of New York City--9.5 million--yet it proudly and legitimately boasts the highest number of long-lived people anywhere in the world. In fact, in the local Caucasian dialects there is no word for "elderly" or "aged," merely the Russian word which means "long-centuried." The last census, taken in 1970, revealed that 5,000 centenarians then lived in the Caucasus.» (...)
    Deve ser por causa da elevada concentração de oxigénio nas montanhas.

    É natural os criacionistas inventarem factos e depois usarem pequenas referências como prova, mas que não admitem as mesmas conclusões. Deixa-me lembrar o que Sabino tinha dito... Ah, não merecem o benefício da dúvida. São palhaços. Os animais que vivem mais tempo são os que movem-se mais devagar, como a tartaruga por isso não consomem tanto oxigénio. Já foram feitos testes com moscas, onde as que tinham liberdade de se moverem mais morreram mais cedo do que aquelas que estavam mais paradas. Olhem bem para os atletas que praticamente todos os dias fazem exercícios aeróbicos. Eles devem parecer muito jovens para a idade, não é?

    Sapo - Mulher:
    «Por que envelhecemos?
    Existem duas grandes causas. Por um lado, respiramos oxigénio e, portanto, oxidamos. A toma de antioxidantes pode minimizar os efeitos nefastos dos radicais livres, provenientes dessa oxidação.» (...)

    iHealthBulletin News - Apnéia moderada pode aumentar a longevidade em idosos?
    «"Esses achados, quando combinadas com novas descobertas na literatura científica da adaptativos influencia da hipóxia intermitente (falta de oxigênio), em diferentes modelos clínicos, reforça a nossa hipótese de que a apnéia do sono ativa mecanismos de defesa das pessoas da terceira idade que lhes dão, com vantagem de sobrevivência", disse Lavie.»

    Curiosidades do mundo animal_
    «O que a ciência atual dá como certo é que, quando um organismo é submetido a um regime de baixas calorias, começa desacelerar seu metabolismo para poupar suas reservas. Assim, o organismo passa a produzir menos "Radicais Livres" (O-, OH- CH3- e H2O2 ou água oxigenada). Os Radicais Livres são uma espécie de resíduo metabólico resultante da oxidação dos nutrientes e são considerados os elementos químicos mais agressivos à integridade física e funcional das células. Estima-se que, cerca de 5% de todo oxigênio consumido seja transformado em radicais livres

    SUPER INTERESSANTE - Desafio à morte:
    «O problema é saber por que alguns insetos marcham com mais lentidão para o fim. A única pista encontrada por Rose são antioxidantes substâncias que, de modo geral, protegem as células contra o excesso de reações com o oxigênio, mas são anormalmente ativas nas moscas de vida longa. Isso é curioso, pois o oxigênio que perambula em estado livre nos organismos é um notório vilão das células, onde danifica proteínas, gorduras e o próprio ácido nucléico, matéria-prima dos genes.»

    Isso tudo é suficiente, ou vai o Sabido vai mais uma vez mostrar que é mesmo um palhaço?

    ResponderEliminar
  70. «"Apesar de algumas mutações terem efeitos benéficos, as moscas dão sempre moscas."»

    Tal como é mostrado com uma simples calculadora: Micro vs. Macro Evolution. Quanto somos dos nossos pais?

    ResponderEliminar
  71. A todos,

    Eu estava enganado. O criacionismo estava certo.

    Estive a investigar melhor, e as MUTAÇÕES NÃO PODEM CRIAR INFORMAÇÃO NOVA.

    Está tudo aqui
    no PiPismo.

    ResponderEliminar
  72. Está sendo acrescentado um grão de cada vez no chão, que começou a estar vazio: quando é que passa a haver um monte ou uma montanha?

    ResponderEliminar
  73. Seria bom o João Vasco ler o livro "Not by Chance" de Lee Spetner, sobre mutações e informação genética. Seria bom, também, dar exemplos de mutações que tenham aumentado a informação genética do organismo e que a mutação não tenha sido apenas recombinação, substituição, troca ou perda de informação genética. É que tanta fé evolucionista nas mutações e o certo é que as bactérias que existiam há 3,5 mil milhões de anos, são as mesmas que existem hoje.

    Seria bom também não responderem 5 vezes a cada comentário, já que torna inviável responder a todas as atoardas.
    _________________________

    O Ludwig diz que "uma coisa é partir de um pressuposto, testá-lo e confiar nele apenas na medida em que passa pelos testes com melhor desempenho que outros pressupostos. Caro professor, isto parecem palavras muito bonitas e muito sinceras mas, a verdade é que não passa disso mesmo... discurso politicamente correcto.

    Quem é que pode confiar no pressuposto uniformitarista, quando temos N exemplos de formações rochosas que surgiram rapidamente, através de catastrofismo?

    Como é que se pode confiar no pressuposto naturalista, se as experiências para tentar criar vida a partir de químicos mortos falham repetida e redondamente? Se se tem vindo a mostrar que a "geração espontânea" não é confirmada pela ciência, então por que não se abandona tal ideia?

    Esse discurso é todo muito bonito mas é conversa para boi dormir.

    ResponderEliminar
  74. Marcos Sabido:
    «Seria bom, também, dar exemplos de mutações que tenham aumentado a informação genética do organismo e que a mutação não tenha sido apenas recombinação, substituição, troca ou perda de informação genética

    Eu estudei Biologia no secundário, e lembro-me muito bem das mutações de inserção - que o desonesto do Sabido não indicou.
    Apesar de eu ser um informático habituado a programar programas informáticos, não sei o que queres dizer com "informação" e como calculas a sua quantidade. Podes-me dizer a diferença de bits entre duas mutações, ou estás a dizer que há perdas de informação só por dizer? Já vimos que gostas de inventar factos, como o oxigénio puro, e que usa termos como se não tivessem significado, como as hortaliças que não são vegetais, e noto que é esse o caso. Dá uma vista de olhos a:
    * Darwinistas mutantes
    * Lecture - 8 Information Theory

    * How Evolution Works Part 4- Mutations
    * How Evolution Causes an Increase in Information
    * Information Theory and Creationism: William Dembski

    * Evolution DOES Increase Genetic Information
    * Genetic Mutation May Lead To Increased Autoimmunity
    * Evolution myths: Mutations can only destroy information
    * Apolipoprotein AI Mutations and Information
    * Evolution and Information: The Nylon Bug
    * Mutation of the ptsG gene results in increased production of succinate in fermentation of glucose by Escherichia coli
    * Examples of Beneficial Mutations and Natural Selection

    Sabido, parece-me que vais passar a ignorar-me porque sabes perfeitamente que não podes meter-te comigo. Eu posso escancarar-te provas na tua cara até tu ajoelhar-tes a pedir clemência. És uma hiena que pensa teres encontrado carcaças, mas tu simplesmente estás a fugir ao assunto.

    O catastrofismo é uma ideia contrária à Teoria da Evolução do século XVIII: Catastrofismo
    Abiogénesis e geração espontânea não são a mesma coisa: por exemplo, seres vivos com a complexidade de um ser humano a surgir do pó é geração espontânea, que não é o caso da hipótese da abiogénese.
    * VenomFangX joking
    * Wikipedia
    * Abiogenesis FAQs
    * Bio-Medicine
    * The Origin of Life - Abiogenesis
    * 3 -- The Origin of Life made easy
    * Creationists and Abiogenesis

    O boi que anda a dormir chama-se Marcos Sabino. Então, não gostaste do oxigénio puro das montanhas?

    ResponderEliminar
  75. Marcos Sabino,

    «Seria bom, também, dar exemplos de mutações que tenham aumentado a informação genética do organismo»

    A duplicação e posterior modificação de um dos duplicados aumenta a informação genética.

    Exemplo:

    1) ATTACAGGAGTTAGACAGATTA

    2) ATTACAGGAGTTAGACAGATTAGAGTTAGACAGATTA
    (por duplicação de GAGTTAGACAGATTA)

    3) ATTACAGGGGTTAGACAGATCAGAGCTAGTCAGATTA

    (após mutações pontuais de substituição).

    Transposões e retrovírus também aumentam a informação no ADN inserindo pedaços novos em sitios onde o organismo não os tinha.


    Mas, mais importante que isto é perceberes (espero que finalmente...) que a evolução se aplica a populações e não a individuos. Por isso o que tens que perguntar é se as mutações aumentam a informação *na população*. E isso é evidente que sim.

    Se tens 100 coelhos brancos e nasce um mutante cinzento agora tens uma população com mais diversidade genética e, por isso, mais informação no total (quanto mais diversos forem mais informação precisas para especificar a população)

    E fica aqui o teste à tua honestidade. Ou admites que as mutações aumentam a informação nas populações (por aumentar a diversidade), ou explicas em que sentido é que um aumento de diversidade de uma população não resulta num aumento de informação.

    Se fizeres o mesmo que o Jónatas e o Mats e fingires que não te explicámos já isto, descerás ao nível de "argumentação" deles, e será pena...

    ResponderEliminar
  76. E a definição de "tipo" Sabino?! É assim tão difícil? Pensava que a bíblia era exacta, clara e precisa!!!

    ResponderEliminar
  77. Sabino:

    «Seria bom, também, dar exemplos de mutações que tenham aumentado a informação genética do organismo e que a mutação não tenha sido apenas recombinação, substituição, troca ou perda de informação genética.»

    Para dar-tos preciso que tu me digas explicitamente o que é "informação".
    Dá-me uma definição tão rigorosa quanto conseguires.

    E respponde-me a uma pergunta. Tens um coelho, e ele tinha um filho que tinha sofrido uma mutação.
    Imagina que essa mutação tinha AUMENTADO a informação. Eu sei que achas que isso é impossível, mas imagina que era possível.
    Imagina que tinha aumentado a informação, mas muito pouco. Que o coelho filho tinha um bocadinho mais informação que o pai, mas que era quase igual.
    A minha pergunta é: como saberias que estavas perante um aumento de informação? Como saberias que aquilo que tinha acontecido era extraordinário? (Um milagre?) O que é que podia ter mudado no coelho (uma mudança pequena), que da tua perspectiva seria um aumento de informação, e portanto um evento milagroso ou impossível?

    ResponderEliminar
  78. Marcos Sabino:

    Mais um exemplo que por acaso até já aqui deixei antes:

    Richard Lenski tem cultivado bacterias E. coli desde ha 44.000 gerações.

    Em 12 colónias separadas mas com origem na mesma E. coli, 20 anos antes. Só uma das 12 populações desenvolveu a capacidade de metabolizar citrato. Mas desenvolveu.

    Só se consegue que essa linhagem volte a dar origem a uma população capaz de metabolizar citrato se se repetir a experiência desde a geração 20000 até um numero proximo do atingido no primeiro resultado.

    Conclusões:

    As mutações que permitiram esta nova capacidade não estavam nas E. coli originais nem nas primeiras 20 mil gerações. Também podemos perceber que varias mutações têm de se acumular ao longo de gerações para que um metabolismo completo do citrato seja formado, porque não acontece de uma geração para outra. As bases que permitem essa evolução só apareceram uma vez, por isso é sempre preciso voltar à geração 20.000.

    Finalmente podemos concluir que a adaptação ao citrato é extremamente rara (em termos de probabilidade de ocorrência) com origem cumulativa de acontecimentos ocasionais(mutações) e levou a existência de uma nova função com vantagem para essa linha genética, porque existia citrato no meio usado e as bactérias podiam viver dele. Isto são factos negados pelo criacionismo.

    A capacidade de usar o citrato é um meio vulgarmente usado em laboratório para excluir E. coli quando se tenta identificar uma bactéria. Ou seja, é algo que a ajuda a definir

    ResponderEliminar

Se quiser filtrar algum ou alguns comentadores consulte este post.