quinta-feira, Março 25, 2010

Lagarto, lagarto, lagarto.

Em três espécies de lagarto do Novo México, Sceloporus undulatos, Apsidoscelis inornata e Holbrookia maculata, os indivíduos das populações que vivem em White Sands têm cor branca, enquanto os seus conspecíficos nas regiões circundantes são mais escuros. White Sands é um deserto de areia branca onde qualquer bicho pequeno e castanho se candidata a refeição de outro maior. Por isso não é de admirar que populações destas três espécies se tenham adaptado perdendo a cor. Mas é um bom exemplo de evolução convergente.

Estas populações perderam a cor devido a alterações na mesma proteína, um receptor no mecanismo de expressão de pigmentos, mas em cada espécie a mutação foi diferente (1). E no caso dos lagartos Holbrookia maculata nem é claro como essa mutação tenha afectado a pigmentação, sugerindo que houve mais alterações genéticas a contribuir para o efeito. Isto mostra que a natureza tem várias formas de obter o mesmo resultado. Os criacionistas gostam de fazer contas à extrema improbabilidade de uma certa proteína ser exactamente assim, ou de certo organismo ser exactamente daquela forma. Mas esses cálculos assumem que o resultado final só pode ser um. Não é preciso. Há muitas maneiras diferentes de ser lagarto, há muitas maneiras diferentes de um lagarto castanho ter descendentes pálidos e, se bem que a vida na Terra como é neste momento seja extremamente improvável, podia ser de qualquer uma de incontáveis formas alternativas que seria vida na Terra à mesma.

Este exemplo também ilustra o processo de especiação. As espécies não surgem num salto mas pelo acumular de diferenças pequenas que, com o tempo, separam irreversivelmente duas linhagens. É o que está a acontecer com estas populações de lagartos.

Dentro de cada uma destas três espécies não há qualquer impedimento genético ao cruzamento de lagartos brancos com lagartos escuros. A diferença genética é irrisória. No entanto, um lagarto branco onde o terreno é escuro corre tanto perigo como um lagarto escuro na areia branca. Por isso, na fronteira entre estas zonas há uma forte pressão selectiva contra o cruzamento de lagartos de cor diferente. Assim, apesar dos lagartos de White Sands serem geneticamente semelhantes aos seus conspecíficos nas redondezas, nas três espécies as populações de lagartos brancos estão a ficar geneticamente isoladas. E sem cruzamentos entre as populações a acumulação de mutações vai inevitavelmente levar à sua separação em espécies diferentes. Para surgir uma espécie nova não é preciso uma lagosta parir um abutre. Basta que uma pequena mutação lance duas populações e caminho do isolamento genético e o tempo trata do resto.

Devo salientar que as mutações que tornaram os lagartos mais claros não surgiram por causa da areia branca. As mutações são aleatórias e desligadas desses factores ambientais que as seleccionam. Nem surgem por desígnio ou inteligência. O que aconteceu foi que os lagartos albinos que, de vez em quando, nasceram fora de White Sands não tiverem o sucesso reprodutivo necessário para fazer vingar essa característica onde o solo era escuro. Mas em White Sands o mesmo acidente genético conferiu uma vantagem reprodutiva e espalhou-se nessa população.

Estes lagartos dão também um exemplo – três, na verdade – de como é ridícula a ideia que as mutações “só degeneram” o DNA. Primeiro porque se uma mutação faz com que um lagarto nasça branco, a mutação inversa pode fazer o seu filho ter novamente a cor do avô. As mutações são aleatórias e não têm uma direcção fixa*. Mas, principalmente, porque o ambiente determina se uma mutação é prejudicial ou benéfica. Não faz sentido considerar que uma mutação que torna os lagartos mais aptos a viver na areia branca tenha “degenerado” a linhagem. Modificou-a aleatoriamente e, porque o ambiente é dinâmico, complexo e muito diverso, algumas modificações aleatórias têm consequências benéficas.

Esta complexidade é outra coisa que escapa aos criacionistas. Para cada gene e para cada genoma, o ambiente não é apenas factores abióticos como a areia e a temperatura do ar. O ambiente é tudo o que interage com esse gene e esse genoma, incluindo todos os outros genes e todos os outros genomas. É esta interacção que, alimentada por mutações aleatórias, impele e guia as linhagens em mudança constante e gera a enorme diversidade de seres vivos que vemos. A cor destes lagartos não foi seleccionada apenas pela cor da areia. Foi seleccionada também pelos genes do sistema visual dos predadores, pelas preferências reprodutivas dos lagartos da mesma espécie, por outros efeitos dos genes envolvidos e assim por diante, numa enorme rede de interacções entre genes, organismos e o terreno onde vivem.

A maior tristeza do criacionismo nem é a incapacidade de explicar esta complexidade. O pior de tudo é a incapacidade de sequer se aperceber dela, imaginando em vez disso um universo de desenhos animados no qual cada bicharoco tem o seu boneco e não passa daquilo.

* Excepto se forem delecções. Se uma parte do DNA se perde, normalmente isso será irreversível. Mas esse é apenas um de vários tipos de mutação, e não é o caso aqui.

1- Rosenblum EB, Rompler H, Schoneberg T, Hoekstra H (2010) The molecular and functional basis of phenotypic convergence. Proc Natl Acad Sci USA 107 2113–2117. Via Discovery News.

Editado às 23:03 para corrigir o Sceloporus undulatos. Obrigado ao sxzoeyjbrhg por ter apontado o erro.

85 comentários:

  1. LAGARTOS, LAGARTOS E APENAS... LAGARTOS!

    Estamos aqui perante “evolução” que não transforma os lagartos noutra espécie diferente e mais complexa, mas apenas altera a respectiva cor.

    Também há pessoas mais claras e mais escuras, que nem por isso deixam de ser pessoas. Na verdade, em praticamente todas as espécies de seres vivos (v.g. plantas, peixes, répteis, maníferos) encontramos grande variedade de cores.

    Os criacionistas nunca colocam em causa essa variedade. Pelo contrário. Ela é uma mais valia estética.

    Os criacionistas limitam-se a dizer que as mutações descritas não introduziram instruções capazes de codificar estruturas e funções inovadoras e mais complexas.

    Nem se diz nada sobre a origem dos lagartos e da informação codificada de que eles dependem.

    Dizer que “as espécies não surgem num salto mas pelo acumular de diferenças pequenas que, com o tempo, separam irreversivelmente duas linhagens” é ignorar que nunca ninguém viu um ser vivo a surgir por esse processo.

    Apenas se vê a diversificação de um género em várias espécies, a partir de um pool genético inicial e dando lugar a diferentes “pool” genéticos mais pequenos.

    Os lagartos vão se especializando, sem nunca deixarem de ser lagartos.

    O facto de se poderem cruzar mostra que são originariamente da mesma espécie.

    A especiação “simpátrica” e “alopátrica”, por via do isolamento reprodutivo ou geográtivo, cria sub-espécies, que derivam de um mesmo género.

    Os criacionistas acreditam inteiramente nisso, dizem que esse processo pode ser muito rápido e explica a diversidade pós-diluviana.

    Só através desse processo é que se explica que dos casais de diferentes géneros presentes na Arca de Noé, pudesse resultar tanta variedade muitas espécies de felinos, répteis, caninos, crustáceos, etc.

    O processo descrito é fundamental para a viabilidade do modelo criacionista bíblico.

    As mutações tendem a degenerar o DNA, sendo a principal causa de doenças de toda a espécie. Isso está amplamente documentado.


    No entanto, algumas alteram aspectos (v.g. cor, quantidade de pelo) que em princípio não essenciais para a vida, embora as circunstâncias envolventes (v.g. predadores; temperatura) possam proceder a uma selecção natural.

    Os criacionistas não negam isso.

    Apenas mostram que a selecção natural implica a perda de informação que codifica para algumas cores ou para determinadas quantidades de pelo, nunca criando estruturas inovadoras mais complexas.


    Dizer que existe aqui alguma coisa que escapa aos criacionistas é ridículo.

    Os processos descritos são totalmente aceites pelos criacionistas! Os criacionistas explicam-nos da mesma maneira! A interpretação é que é diferente.

    Os criacionistas apenas dizem que neste exemplo, os lagartos continuam a dar lagartos, embora com cores diferentes!

    Nalguns casos isso pode ser bom para os lagartos, e noutros não!

    Quando não é, eles morrem e perde-se a respectiva informação genética.

    Este argumento é uma variante do “gaivotas dão gaivotas”, só que agora é “lagartos dão lagartos”! Como disse, os criacionistas não têm nada a objectar.

    Lagartos dão efectivamente lagartos e só lagartos!

    ResponderEliminar
  2. Perspectiva:

    Imagine que não tinha razão, e que uma mutação criava informação. Eu sei que não acredita nisso, mas imagine.
    Nesse caso, qual seria a evidência mais pequena que o convenceria de que estava errado?

    Qual seria a diferença fisiológica mais pequenina que uma mutação poderia provocar num lagarto para o Perspectiva dizer «afinal estava enganado»? «Eu pensava que as mutações não causavam aumento de informação, mas afinal causam».

    Se o Perspectiva confiar na sua teoria, pode responder à vontade, com mudança fisiológicas bem pequeninas, pois sabe que elas nunca serão observadas.

    Mas se é para dizer que o filho de um lagarto é sempre um lagarto, está enganado. Algures os antepassados distantes dos elefantes foram os mamutes, portanto o nome pode mudar, certo? E se muda o nome mas não o tipo, falta definir "tipo" para que isso queira dizer alguma coisa. Se não, o Ludwig também diz que na evolução o tipo é sempre o mesmo: «ser vivo».

    ResponderEliminar
  3. Jónatas,

    «Dizer que “as espécies não surgem num salto mas pelo acumular de diferenças pequenas que, com o tempo, separam irreversivelmente duas linhagens” é ignorar que nunca ninguém viu um ser vivo a surgir por esse processo.»

    Há árvores com milhares de anos de idade que ninguém viu nascer, nem crescer durante a maior parte da vida dessas seres. Há montanhas que ninguém viu formar-se, a areia é o resto de rochas que ninguém viu desfazer-se e, já agora, a maior parte das coisas que se relata no Génesis são coisas que ninguém viu. Ninguém viu um deus a separar as águas, a criar estrelas, a fazer plantas e animais.

    Mas vemos árvores com várias idades diferentes, vemos que têm certas diferenças previsíveis e conseguimos inferir daí o seu processo de crescimento. Vemos vários estados de erosão em vários sítios, montanhas com aspectos diferentes que nos indicam a sua idade e assim por diante. Das tretas do Génesis é que não há sinal.

    E nos seres vivos vemos toda a gama de diferenças. Populações isoladas dentro de uma mesma espécie, espécies em anel onde populações nos extremos não se conseguem cruzar, espécies parecidas mas separadas, espécies um pouco mais diferentes, que divergiram à mais tempo, como nós e o chimpanzé. E assim por diante até aos exemplares mais distantes, como a lontra e o bacilo da tuberculose.

    Não temos vida que chegue para ver o processo todo a decorrer. Mas temos diante dos olhos muitos exemplos de todas as fases do processo. E só não vê quem não quiser.

    ResponderEliminar
  4. Ludwig:

    "Foi seleccionada também pelos genes do sistema visual dos predadores, pelas preferências reprodutivas dos lagartos da mesma espécie, por outros efeitos dos genes envolvidos e assim por diante, numa enorme rede de interacções entre genes, organismos e o terreno onde vivem."

    Esta explicação não é cientifica. Não estas a reduzir a frequência genética dos alellos a uma única causa. É um ultrage. Estas a propor que haja um fim para a cor do lagarto, que é ter sucesso ao nivel de realidade do sexo (reprodução é o quê afinal? É a desculpa para ter sexo. Pergunta a qualquer adolescente), em vez dele estar lá só por acaso.

    ResponderEliminar
  5. LUDWIG KRIPPAHL E UM INCAUTO CIDADÃO:

    LK: Sabes, estou absolutamente convencido que os micróbios se transformaram em microbiologistas ao longo de milhões de anos!!

    IC: A sério? Grandes afirmações exigem grandes evidências!! Quais são as tuas?

    LK: É simples! O meu “naturalismo metodológico” e o meu “empírico” são infalíveis porque só se limitam àquilo que se vê. Se olhares bem à tua volta descobres que:

    1) moscas dão… moscas

    2) morcegos dão… morcegos

    3) gaivotas dão… gaivotas

    4) bactérias dão… bactérias

    5) escaravelhos dão… escaravelhos

    6) tentilhões dão… tentilhões

    7) celecantos dão… celecantos (mesmo durante supostos milhões de anos!)

    8) guppies dão… guppies

    9) lagartos dão… lagartos

    IC: Mas...espera lá! Não é isso que a Bíblia ensina, em Génesis 1, quando afirma, dez vezes, que os seres vivos se reproduzem de acordo com o seu género?

    LK: Sim, mas os órgãos perdem funções, total ou parcialmente

    IC: Mas…espera la! A perda total ou parcial de funções não é o que Génesis 3 ensina, quando afirma que a natureza foi amaldiçoada e está corrompida por causa do pecado humano? É isso, e só isso, que se vê!

    Afinal, os teus exemplos de “naturalismo metodológico” e “empírico” corroboram o que a Bíblia ensina!!

    Não consegues dar um único exemplo que demonstre realmente a verdade aquilo em que acreditas?

    LK: …a chuva cria informação codificada…

    IC: pois, pois… e o guarda-chuva transcreve, traduz, copia e executa essa informação codificada…

    LK: o criacionismo é mesmo uma tristeza… não consegue compreender a complexidade das coisas…

    ResponderEliminar
  6. Prepy:

    "Dizer que “as espécies não surgem num salto mas pelo acumular de diferenças pequenas que, com o tempo, separam irreversivelmente duas linhagens” é ignorar que nunca ninguém viu um ser vivo a surgir por esse processo. "

    Dizer que se uma pessoa fizer um buraco até ao centro da terra e continuar vai acabar por sair do outro lado é ignirar que nunca ninguem viu isso.

    Assim é que é. Argumentos de peso.

    ResponderEliminar
  7. 1) moscas dão… moscas

    2) morcegos dão… morcegos

    3) gaivotas dão… gaivotas

    4) bactérias dão… bactérias

    5) escaravelhos dão… escaravelhos

    6) tentilhões dão… tentilhões

    7) celecantos dão… celecantos (mesmo durante supostos milhões de anos!)

    8) guppies dão… guppies

    9) lagartos dão… lagartos

    10) Prespectivas dão... borrada.

    ResponderEliminar
  8. Joao

    Se fosse feito um buraco até ao centro da terra ficaria presa na singularidade que se esconde na fórmula da gravidade : ))

    F = \frac{G m_1 m_2}{r^2}

    Quando R = 0 --> inf

    Mistérios

    ResponderEliminar
  9. Estas caixas não permitem símbolos matemáticos :S

    ResponderEliminar
  10. Aliás, somar 400000 mil biliões de perspectivas a um e dizer que dá 400000 mil bilioes e uma perspectiva é ignorar que nunca ninguem viu isso.

    ResponderEliminar

  11. IC: Mas...espera lá! Não é isso que a Bíblia ensina, em Génesis 1, quando afirma, dez vezes, que os seres vivos se reproduzem de acordo com o seu género?


    E se misturarmos um leão com um tigre ?

    Não são do mesmo tipo e um ligre mesmo sendo uma mula ( é estéril ) é um ser vivo.
    A bíblia enganou-se ?
    http://en.wikipedia.org/wiki/Liger

    ResponderEliminar
  12. Estou enganado, afinal
    "In Wild Cats Of The World (1975), Guggisberg wrote that ligers and tiglons were long thought to be sterile; in 1943, however, a fifteen-year-old hybrid between a lion and an "Island" tiger was successfully mated with a lion at the Munich Hellabrunn Zoo. The female cub, although of delicate health, was raised to adulthood."

    foideusse

    ResponderEliminar
  13. Nuvens:

    Há! estas a usar uma formula Newtoniana. Reconheço o cheiro a mofo. Não sei se a relatividade tem esse problema.

    De qualquer modo nota que a singularidade só ocorre no ponto 0. É muito pequenino. E isso existe em todos os corpos - é o centro de massa. Tem particularidades muito interessantes. Ja tinhas pensado nisso.

    ResponderEliminar
  14. RESPOSTA AO LUDWIG:

    "Há árvores com milhares de anos de idade que ninguém viu nascer, nem crescer durante a maior parte da vida dessas seres."

    É interessante notar os testes de dendrocronologia que se baseiam apenas na contagem dos aneis do respectivo das mesmas (e não em extrapolações baseadas em C-14) dão idades inferiores ao dilúvio...

    Até Richard Dawkins reconhece, no seu último livro, que não vamos muito longe com as datações da dendrocrolonogia...

    "Há montanhas que ninguém viu formar-se, a areia é o resto de rochas que ninguém viu desfazer-se e, já agora, a maior parte das coisas que se relata no Génesis são coisas que ninguém viu."

    Na verdade, Génesis é claro quando afirma que só Deus observou a criação, pelo simples facto de que o ser humano foi criado ao 6 dia....

    O dilúvio continua a ser a melhor explicação para a elevação das montanhas, considerando que no seu cume se encontram por vezes fósseis de moluscos e que a sua elevação foi muito recente mesmo de acordo com as datações da geologia tradicional...


    "Ninguém viu um deus a separar as águas, a criar estrelas, a fazer plantas e animais."

    Só Deus viu isso, e só Ele pode falar com autoridade sobre a criação. A Bíblia é clara quando diz que não foi escrita por vontade de homens, mas por inspiração de Deus.

    A sua relevância no século XXI permite corroborar isso.

    "Mas vemos árvores com várias idades diferentes, vemos que têm certas diferenças previsíveis e conseguimos inferir daí o seu processo de crescimento."

    Os criacionistas também fazem essas inferências.

    Apenas dizem que o crescimento executa informação codificada, reproduzindo-se de acordo com o seu género, de forma a que as macieiras não produzam laranjas ou peras...

    "Vemos vários estados de erosão em vários sítios, montanhas com aspectos diferentes que nos indicam a sua idade e assim por diante."

    O aspecto não indica a idade. Existem canyons em tudo iguais aos que parecem ter milhões de anos que foram produzidos catastroficamente em poucos dias e há poucos anos...

    O advento do neo-catastrofismo na geologia baseia-se na evidência de sedimentação catastrófica... As falésias de Dover são disso um óptimo exemplo... entre muitos outros...

    "Das tretas do Génesis é que não há sinal."

    Bem, o Génesis diz que os seres vivos se reproduzem de acordo com o seu género e tudo indica que lagartos dão lagartos...

    "E nos seres vivos vemos toda a gama de diferenças."

    As diferenças apenas demonstram a existência de diferenças...


    "Populações isoladas dentro de uma mesma espécie, espécies em anel onde populações nos extremos não se conseguem cruzar"

    A perda da função reprodutiva dentro de espécies do mesmo género é apenas um exemplo de perda de função e não do surgimento de uma função mais complexa...

    Nos seres humanos também há homens e mulheres que perderam a função reprodutiva...

    "...espécies parecidas mas separadas, espécies um pouco mais diferentes"...

    A especialização da informação dá, indiscutivelmente, lugar a sub-espécies, com menos informação, e nem sempre com capacidade de reprodução... as mulas não se reproduzem...

    "....que divergiram à mais tempo, como nós e o chimpanzé."

    Diferenças e semelhanças não signiicam antepassado comum. Elas fazem todo o sentido do ponto de vista de um Criador comum...


    "E assim por diante até aos exemplares mais distantes, como a lontra e o bacilo da tuberculose."

    Um é evidência de criação, ao passo que outro é evidência de corrupção... Génesis tem a resposta...

    "Não temos vida que chegue para ver o processo todo a decorrer. Mas temos diante dos olhos muitos exemplos de todas as fases do processo."

    O que temos diante dos olhos são apenas animais, plantas e seres humanos que são contemporâneos entre si, juntamente com os fósseis muitos seres vivos que catastroficamente sepultados nos cinco continentes....

    E só não vê quem não quiser.

    ResponderEliminar
  15. Nuvens:

    A hibridação e a transferencia horizontal de genes é uma realidade. Existiu desde sempre. Razão pela qual eu não acredito Luca (last universal comon ancestral) . Aquilo era uma confusão e marchava tudo.

    ResponderEliminar
  16. "E só não vê quem não quiser."

    Não vez que estou numa discussão "off-topic"??? Será que nem isso respeitas? Pensei que era o teu forte. Basa.

    ResponderEliminar
  17. "Não são do mesmo tipo e um ligre mesmo sendo uma mula ( é estéril ) é um ser vivo."

    O Perspectiva diria mais uma vez que a realidade é que se enganou!! Pois o que está certo é o que está escrito no livrinho...
    A mim parece-me óbvio que é obra do Diabo!!

    ResponderEliminar
  18. O centro de massa é como se tivesse de facto massa infinita - em relação ao resto do objecto. So aparece com o movimento, pelo que não existe ponto 0 em objectos parados. (isto esta cada vez melhor)

    ResponderEliminar
  19. UMA NOTÍCIA INTERESSANTE:

    Chamo a atenção para a descoberta de mais um dinossauro notavelmente bem preservado, nas montanhas vermelhas do Utah, e com evidência de ter sido sepultado abruptamente...

    Por esta altura já todos sabem como os criacionistas interpretarão este achado...

    Vejamos o que futuras investigações trarão a lume...

    New Dinosaur from Utah's Red Rocks
    ScienceDaily (Mar. 24, 2010)

    ResponderEliminar
  20. A de Newton chega para o que estamos a falar, mas a outra com a velocidade da luz tb tem o mesmo problema que é apenas uma brincadeira (r=0) e que resulta apenas de uma impossibilidade matemática.
    Na prática estarias a flutuar, puxado com a mesma força por todos os lados, nas suposição que a terra é uma esfera perfeita :D

    Mas haverá por aqui verdadeiros especialistas de física :D, eu fui em tempos mero iniciado nas suas artes negras, LOLLLLLLLLL

    ResponderEliminar
  21. Nuvens:

    E quando digo que marchava tudo, quero dizer mesmo tudo. O Ludwig tem para ai um post interessante que sugere que um buraco cruzou com uma molecula de RNA.

    Ludwig:

    És capaz de dizer onde isso anda? Por acaso queria aceder-lhe.

    ResponderEliminar
  22. "uz tb tem o mesmo problema que é apenas uma brincadeira (r=0) e que resulta apenas de uma impossibilidade matemática."

    SIm x/0 é uma operação que não se sabe resolver matematicamente. Não dá infinito no entanto.

    Em todo o caso, empiricamente sabemos que é ali defacto a força zero porque todas as linhas lá convergem, mas é onde está o peso todo se o objecto se mover.

    ResponderEliminar
  23. "Chamo a atenção para a descoberta de mais um dinossauro notavelmente bem preservado, nas montanhas vermelhas do Utah, e com evidência de ter sido sepultado abruptamente..."

    Pois foi! Foi sepultado abruptamente numa duna eólica sub-aérea!! Aliás a côr vermelha das rochas é causada pela oxidação de alguns minerais ferro-magnesianos, o que mostra que estas se formaram em contacto com o oxigénio atmosférico.. Gostava de saber como é que o Dilúvio é responsável pela formação de uma duna eólica!!?? Já ouviram falar em tempestades de areia?!!

    "Por esta altura já todos sabem como os criacionistas interpretarão este achado..."

    De forma errada obviamente! Não percebem patavina de geologia!
    Por isso nem sequer conseguem interpretar o que quer que seja, limitam-se a dizer que já sabiam a resposta.. Brilhante!

    ResponderEliminar
  24. "um dinossauro notavelmente bem preservado"

    Não sei o que queres dizer com isto, mas o que foi encontrado foi um esqueleto parcial!!

    ResponderEliminar
  25. Nuvens,

    Casos de híbridos férteis são conhecidos para algumas espécies -- já ouvi falar disso em mulas também.

    O problema é que quando tens um mismatch grande demais nos genes e cromossomas é muito difícil aos gâmetas formarem-se, porque a meiose depende do emparelhamento correcto dos cromossomas dos dois progenitores.

    Mas muito difícil não é necessariamente impossível, e como o organismo vai tentando muitas e muitas vezes, em alguns casos ainda dá.

    A diferença entre as espécies não é uma barreira criada por um deus mas um efeito estatístico da facilidade ou dificuldade de segregar os cromossomas durante a meiose.

    ResponderEliminar
  26. Perspectiva:

    Vejo que, como de costume, continua com dificuldades em responder às perguntas que lhe faço...

    ResponderEliminar
  27. E já agora.. devo informar que a duna se encontra fossilizada o que também não abona muito a favor dos 6000 anos..

    ResponderEliminar
  28. Genial,

    «The beautifully preserved specimen includes most bones of the skeleton, except for the head, and parts of the neck and tail. Seitaad was found in fossilized sand dunes that were part of a vast desert that covered the region nearly 185 million years ago during the Jurassic Period. Research suggests that the animal was buried in a suddenly collapsing sand dune that engulfed the remains and stood them on their head. The missing parts of the skeleton were lost to erosion over the past thousand years, but were almost certainly visible when Native Americans lived on the cliff just above the skeleton.»

    Se a evidência indica que foi soterrado por uma duna num deserto há 185 milhões de anos, a única interpretação viável é que morreu afogado num dilúvio enquanto Noé andava de barco com o resto da bicharada, a caminho da Australia para deixar lá os cangurus.

    Link.

    João Moedas,

    Se calhar não devias ter mencionado isso. Assim esperava que o Mats ou o Sabino escrevessem sobre este magnifico achado que refuta de uma vez por todas o darwinismo e já tinha uma treta para essa semana :)

    ResponderEliminar
  29. Ludwig,

    Desculpa-me pela minha precipitação :)
    Mas ainda tenho esperança que o Perspectiva e companhia tenha uma resposta à altura ;)

    ResponderEliminar
  30. joao_moedas

    tenho esperança que o Perspectiva e companhia tenha uma resposta à altura ;)

    foi deus....

    ResponderEliminar
  31. Excelente.

    Lagartos que geram lagartos são evidência contra a Bíblia.

    Impressionante.

    ResponderEliminar
  32. Mats,

    Imagina que não tinhas razão, e que uma mutação criava informação. Eu sei que não acreditas nisso, mas imagina.
    Nesse caso, qual seria a evidência mais pequena que te convenceria de que estavas errado?

    Qual seria a diferença fisiológica mais pequenina que uma mutação poderia provocar num lagarto para dizeres «afinal estava enganado»? «Eu pensava que as mutações não causavam aumento de informação, mas afinal causam».

    Se confias na sua teoria, podes responder à vontade, com mudança fisiológicas bem pequeninas, pois sabes que elas nunca serão observadas.

    Mas se é para dizeres que o filho de um lagarto é sempre um lagarto, estás enganado. Algures os antepassados distantes dos elefantes foram os mamutes, portanto o nome pode mudar, certo? E se muda o nome mas não o tipo, falta definir "tipo" para que isso queira dizer alguma coisa. Se não, o Ludwig também diz que na evolução o tipo é sempre o mesmo: «ser vivo».

    ResponderEliminar
  33. a pergunta do João Vasco ao Mats parece-me um bocadinho familiar

    ResponderEliminar
  34. Sim, falam tanto, mas respondem pouco...

    ResponderEliminar
  35. Farei a mesma pergunta ao Sabino, se aparecer ;)

    ResponderEliminar
  36. João Vasco,

    Nesse caso, qual seria a evidência mais pequena que te convenceria de que estavas errado?


    Processos naturais que sejam capazes de gerar o mínimo de informação codificada que possa servir de caminho para organismos mais complexos.

    Acho que já tinhamos falado sobre isso. Se bem me lembro dei-te a analogia de uma maquina que só imprime as letras "M A T S" e outra máquina que imprima "S E R G I O".

    Como é que nós vemos qual é o sistema que tem mais informação? Neste caso, aquele que executa mais funções específicas.

    De acordo com evolucionistas (e não evolucionistas) eminentes, isso nunca aconteceu com as formas de vida. Tudo o que se observa são variações à volta de um núcleo central, sem progressso nenhum que sirva de exemplo para o mítico "processo evolutivo".

    "Biophysicist, Lee Spetner in his book, Not by Chance, argued that every mutation he had studied had led to the gene becoming less specific in its function. Geneticist, John Sanford, in his book, Genetic Entropy and the Mystery of the Genome also argues that he has never come across a mutation that clearly increases information, meaning that he’s never seen anything that looks as if it could contribute to the evolution of a new organ or structure."


    Para veres que este ponto não é invenção criacionista, nota o que diz Pierre Grasse, de quem Theodosius Dobzhansky diz ser "impossível de ignorar":

    Grassé regards the "unceasing mutations" to be "merely hereditary fluctuations around a median position; a swing to the right, a swing to the left, but no final evolutionary effect."

    Quanto ao aumento de informação que se expresse de forma fisiológica: a minha resposta, pela natureza da pergunta, será insatisfatória para ti. Afinal, como é que se sabe o que a nova informação se pode expressar?

    Nova informação, depende da vontade de quem a codifica. Quem é que sabe o que mentes livres podem gerar, e como?

    Para mim, se um lagarto começasse a ter a capacidade dos mamíferos de produzir leite para as crias, isso seria muito complicado de explicar com a Bíblia. Se se demonstrasse que essa linhagem de lagartos nunca havia sido reportada com essa capacidade, e, do nada, ela começasse a produzir leite tal como os mamíferos produzem, e começasse a amamentar as crias, isso destruiria o argumento de "não há nova informação a produzir-se como efeito de processos naturais".

    Mas não creio que a ciência alguma vez vá documentar isso, porque a informação, pela sua própria natureza, é sempre o resultado de uma ou mais mentes.

    ResponderEliminar
  37. Eu recebi a resposta do MATS mas não percebi patavina, Nova informação, depende da vontade de quem a codifica.

    Isto não faz sentido nenhum :S.
    Para mim, se um lagarto começasse a ter a capacidade dos mamíferos de produzir leite para as crias, isso seria muito complicado de explicar com a Bíblia.

    E há alguma coisa que seja possível de explicar com a biblia ?

    enfim é fim de tarde e vou é embora

    ResponderEliminar
  38. Mats:

    A resposta que eu pediria à minha pergunta é algo deste tipo:

    «Para mim, se um lagarto começasse a ter a capacidade dos mamíferos de produzir leite para as crias, isso seria muito complicado de explicar com a Bíblia. Se se demonstrasse que essa linhagem de lagartos nunca havia sido reportada com essa capacidade, e, do nada, ela começasse a produzir leite tal como os mamíferos produzem, e começasse a amamentar as crias, isso destruiria o argumento de "não há nova informação a produzir-se como efeito de processos naturais".»

    Perfeito. Só me falta perguntar uma coisa: é mesmo esta a transformação mais pequena que te levaria a concluir que uma mutação pode criar informação?

    Pareceu que deste isso como um exemplo de uma possível mutação que te levaria a concluír isso. Mas não como o efeito fisiológico mais discreto que te levaria a essa conclusão.

    De qualquer forma, imagina o seguinte: por alguma razão vives centenas de anos. Vês os lagartos de hoje a mudarem gradualmente, e uma determinada espécie vai mudando gradualmente e ao fim de várias centenas de anos dariam leite aos filhos. Nesse caso, concluirias que algures houve um incremento de informação - que não conseguiste identitficar? - ou que explicação darias, caso visses isso?

    ResponderEliminar
  39. João Vasco,

    Perfeito. Só me falta perguntar uma coisa: é mesmo esta a transformação mais pequena que te levaria a concluir que uma mutação pode criar informação?


    Se se pudesse demonsrar que não houve interacção inteligente, esta é *uma* transformação que me levaria a ver que é possível que processos naturais possam organizar a matéria de modo a construir sistemas funcionais que dantes não existiam.

    Pareceu que deste isso como um exemplo de uma possível mutação que te levaria a concluír isso. Mas não como o efeito fisiológico mais discreto que te levaria a essa conclusão.


    Depende do que entendes por "discreto". Tal como eu disse, a natureza da tua pergunta teria como retorno uma resposta insatisfatória. Daquilo que pude ler no livro do Michael Denton, por vezes basta uma modificação num único gene para que haja complicações que afectam mais do que um órgão. O exemplo que ele dá no livro envolve um gene que afecta a respiração, o sistema de vôo e outras coisas mais.

    Por isso, o teu "exemplo mais discreto" não só pode não ser assim tão discreto, como pode ser expresso de uma forma fisiológica bem visível.

    Como tal, acho que mantenho o que disse em cima.

    De qualquer forma, imagina o seguinte: por alguma razão vives centenas de anos. Vês os lagartos de hoje a mudarem gradualmente, e uma determinada espécie vai mudando gradualmente e ao fim de várias centenas de anos dariam leite aos filhos. Nesse caso, concluirias que algures houve um incremento de informação - que não conseguiste identitficar? - ou que explicação darias, caso visses isso?

    Que houve incremento de informação algures, e levando em conta os requerimentos que disse na primeira resposta, sem duvida que houve. Se o dito réptil não produzia leite, nao tinha orgãos para tal, não tinha a bioquímica pronta para isso, etc, etc, então houve "algo" que lhe conferiu essas capacidades.

    Agora interessava saber o que (ou Quem) causou esse "milagre".

    ResponderEliminar
  40. Mats,

    Algumas bactérias ganharam a capacidade de degradar nylon através de uma mutação num gene. Será que chega para mostrar "nova informação"? Sem dúvida que ganharam nova funcionalidade. Ganharam uma fonte de alimento.

    Ou será que foi Deus que colocou lá a informação para degradar nylon, prevendo que 6 a 10 mil anos depois os humanos iriam inventar e disseminar no ambiente esse material?

    ResponderEliminar
  41. Ludwig:

    Obrigado pelo link.

    ResponderEliminar
  42. Prespec:

    O que estava bem preservado? Os ossos?

    ResponderEliminar
  43. Nelson:

    O Mats acha que o nylon ja ca estava desde o principio da Terra, e que havia aviões e tudo.

    O caso é mais grave do que o que parece.

    ResponderEliminar
  44. Aqui estão alguns artigos para complementar o post:

    Convergent mutations produce convergent colors

    http://whyevolutionistrue.wordpress.com/2010/01/06/convergent-mutations-cause-convergent-colors/

    Three desert lizards evolve white skins through different mutations to the same gene

    http://scienceblogs.com/notrocketscience/2009/12/three_desert_lizards_evolve_white_skins_through_different_mu.php

    E mais esta notícia na secção de ciência do New York Times:

    http://www.nytimes.com/2010/01/05/science/05oblizard.html?ref=science

    Só uma correcção: não é Sceloporus ondulatos mas sim Sceloporus undulatus

    ResponderEliminar
  45. Ludwig:

    Tens de ler algumas pérolas do Miguel. Não acreditas nos niveis, então toma lá:

    "Todos os níveis da Realidade estão interconectados através da complexidade. De um ponto de vista transdisciplinar, a complexidade é a forma moderna do princípio antigo da interdependência universal. O princípio da interdependência universal encerra a máxima simplicidade possível que a mente humana pode imaginar, a simplicidade da interacção entre todos os níveis da realidade. Esta simplicidade não pode ser apreendida pela lógica matemática, mas apenas pela linguagem simbólica."

    ResponderEliminar
  46. Juro que nao percebo este pessoal. Usam a ciencia... sabem que funciona. Quando tem um problema de coraçao vao ao cardiologista, se tem cancro vao ao oncologista para ter uma soluçao. Se precisam de uma casa vao ao arquitecto, ao engenheiro, etc. Se necessitarem de viajar confiam nos engenheiros aeronauticos e nos pilotos, etc. Se necessitarem de um material supercondutor para um novo produto admitem o trabalho dos quimicos. Para colocar satelites em orbita aceitam os conhecimentos dos astrofisicos, dos engenheiros aeronauticos, etc...
    No entanto, quando se trata de Geologia, Biologia, Genetica, e outras ciencias que tais, de repente sabem tudo porque leram UM livro e nao hesitam em ruminar ignorancias escritas por nescios da idade do bronze... haja paciencia para estes santinhos!...

    Excellent blog, by the way!
    Cheers.

    ResponderEliminar
  47. Jonatas Machado (aka Prespectiva),

    "....que divergiram à mais tempo, como nós e o chimpanzé."

    Diferenças e semelhanças não signiicam antepassado comum. Elas fazem todo o sentido do ponto de vista de um Criador comum...


    Acontece que há semelhanças genéticas que dificilmente são explicadas por um criador comum. Como por exemplo DNA viral inserido EXACTAMENTE nos mesmos locais tanto no genoma humano como no dos chimpanzés.

    Vamos lá ver se consigo ensinar um bocadinho de biologia ao sr. prof. de direito constitucional. Os chamados retrovirus transportam RNA que dentro das células infectadas é convertido em DNA, que posteriormente é integrado no DNA da célula hospedeira. Uma vez integrados estes vírus podem ficar "adormecidos" durante muito tempo (por vezes até décadas). Se sofrerem mutações até podem ficar inactivados para sempre.

    Se este processo acontecer numa célula sexual (espermatozóide, óvulo ou seus percursores) o retrovirus é passado aos descendentes. Se estiver inactivado, passa inofensivamente a fazer parte do genoma de todos os descendentes.

    Ora, este fenómeno raríssimo, aconteceu muitas vezes ao longo nossa evolução, pois o nosso genoma possui inúmeros pedaços de DNA retroviral. O curioso é que se compararmos com o genoma dos chimpanzés, lá estão eles também, e inseridos exactamente nos mesmos sítios. E não são meia dúzia, são dezenas (creio que mais de 90!). E sim, os retrovirus têm alguma preferência por locais de inserção, mas as sequências que eles procuram para isso existem em grande número. A probabilidade de duas espécies terem dezenas de retrovirus exactamente nos mesmos locais do seu DNA, por mero acaso, são astronomicamente pequenas. A única explicação credível é um antepassado comum.

    Mais, ao examinar o genoma de espécies com grau de parentesco mais distante, encontram-se também lá alguns dos mesmos vírus em comum, mas menos do que nos chimpanzés. Exactamente como seria de prever pela teoria da evolução.

    Porque haveria o sábio criador colocar DNA que na sua maioria é essencialmente lixo, exactamente nos mesmos sítios no genoma dos chimpanzés e outras espécies? Até já foi encontrada utilidade para alguns desses retrovirus no nosso DNA, mas pq usar DNA viral e não outra solução? Segundo a historia criacionista os vírus e essas coisas que provocam doenças não é suposto só terem aparecido depois da "queda"? O criador já os tinha feito e usado o seu DNA noutras criaturas, mas não os tinha lançado na natureza???

    Enfim, mais uma vez é uma carrada de questões sem qualquer explicação que faça muito sentido. Só se é tudo uma grande partida do criador... q fez isto tudo para nos enganar! Grande malandro!

    Antigamente os criacionistas diziam q tinha sido o diabo a enterrar fosseis para nos fazer duvidar da bíblia. Se calhar também andou a meter vírus! :)

    ResponderEliminar
  48. Nelson Cruz,

    "Só se é tudo uma grande partida do criador... q fez isto tudo para nos enganar!"

    Foi tudo uma grande partida do criador... Não só propositadamente nos enganou com os retrovirus, como com todo o Universo em geral. Por exemplo, quando o criador fez a luz, fê-la já "em trânsito", isto é, parte da luz foi criada há dez mil anos já "em andamento" para dar a ideia que foi criada há 14 mill milhões de anos.

    É ou não é uma valente partida criar luz há dez mil anos com a aparência de 14 mil milhões e ao sexto dia criar um ser inteligente capaz de interpretar erradamente a idade do Universo, pois esse ser baseia-se exactamente nessa luz em trânsito propositadamente feita para o enganar?

    Agora mais a sério... Pergunto-me como é possível alguém dizer coisas como a luz em trânsito sem se rirem. Como é que não se apercebem de que estão a tentar torcer completamente a realidade até que esta se encaixe nas suas ideias pré-concebidas.

    Por exemplo, esta passagem sobre a luz em trânsito é deliciosa:

    Some Christians have proposed that God created the beams of light from distant stars already on their way to the earth. After all, Adam didn’t need any time to grow from a baby because he was made as an adult. Likewise, it is argued that the universe was made mature, and so perhaps the light was created in-transit.

    Em vez de admitirem que provavelmente a ideia pré-concebida sobre a idade do Universo que tinham poderia estar errada, apontaram logo a hipótese da luz em trânsito. Mas melhor ainda, é a forma como o justificam. Pois se o Adão já foi feito adulto, porque razão é que o Universo não poderá também ter sido feito já "adulto"?

    Mais informação sobre a luz em trânsito aqui.

    ResponderEliminar
  49. Nelson e Pedro,

    O Ludwig já fez um post sobre essa temática. Não me lembro exactamente quando, mas tinha a ver com o quão fidedignas eram as previsões de teorias científicas, e quão fácil era "ajustar" a teoria para acomodar o surgimento de provas que contradizem a dita teoria. O argumento era que quanto menos a teoria errava e mais dificil era fazer alterações à teoria, mais consistente era a mesma.

    Essa teoria da criação da luz em trânsito é um bom exemplo (usando este critério) de como a teoria da criação não é muito consistente, já que dadas provas de que há coisas que existem (ou aparentam existir) há mais dos 10,000 anos que essa teoria propõe para a Terra, é fácil alterar a teoria para "ah, isso... isso foi criado já em trânsito".

    Imagino que será mais fácil ao Ludwig do que a mim encontrar o post a que me refiro :)

    ResponderEliminar
  50. Nelson Cruz,
    Algumas bactérias ganharam a capacidade de degradar nylon através de uma mutação num gene. Será que chega para mostrar "nova informação"? Sem dúvida que ganharam nova funcionalidade. Ganharam uma fonte de alimento.


    Curiosamente, coloquei no meu blog há dias um texto que fala sobre isso mesmo.

    Nylon, Bactérias e Mitologia Evolutiva
    Contrariamente ao que os ateus pensam, a capacidade de absorver nylon não é evidência para a evolução, e muito menos é evidência contra a Bíblia.

    ResponderEliminar
  51. Nelson,
    Já deverias saber que o retrovirus não é evidência para a evolução.

    Deixa-me fazer uma pergunta: se se encontrar o mesmo retrovirus no MESMO local nos patos, o que é que vais concluir? Que temos um parente comum com os patos?

    Mas claro, para ti TODA A VIDA tem um parente comum, certo?

    ResponderEliminar
  52. Mats:

    O teu texto é ridiculo.

    Então tu acabas por aceitar que existe uma função nova, aceitas que foi consequente de uma mutação, dás graças a deus, e depois concluis que não esta de acordo com a evolução porque não aumenta a informação?

    Deste graças a deus porque? Porque a informação é a mesma que antes ou diminuiu? A informação tinha aumentado mesmo que não se conseguisse fazer nada com ela.

    Dou-te um palpite. Quando deres graças a deus por algo, se calhar é porque houve evolução, mesmo que aches que foi graças a deus.

    ResponderEliminar
  53. Mats:

    Há dois tipos de pessoas. Os Arrozistas, e os Piquistas.

    Os Arrozistas acreditam que se tu tiveres um prato vazio, e fores acrescentando arroz grão a grão, consegues passar de POUCO arroz, para MUITO arroz.

    Os Piquistas acreditam que isso é um mito. É impossível, qualquer que seja o grão que acrescentes, que aquilo que era pouco arroz, se transforme em muito.

    E se qualquer que for o grão acrescentado, essa alteração não acontece - concluem - então por muitos grãos que acrescentes (um a um), essa transformação não vai acontecer.

    Os arrozistas querem mostrar aos Piquistas que estão enganados, então pedem-lhes que eles digam um número: «com quantos grãos é que passa a ser muito?». Os piquistas tentam evitar dar uma resposta. Afinal de contas, alegam, «muito» não é uma expressão que se refira a um número particular de grãos de arroz.
    Mas um Piquista, convicto de que tem razão, e que não pode ser encontrado o grão que transforma um monte de arroz num grande monte de arroz, diz que «muito corresponde a 5000 grãos».

    Os arrozistas estão contentes. Finalmente um piquista foi concreto. Agora podem mostrar que ele está errado, é só uma questão de mostrar: aumenta-se um a um até chegar aos 4999 grãos, e acrescenta-se mais um. Assim ele vê o conjunto a atingir aquilo que ele disse ser «muito».

    Imagina o desespero quando de repente ele diz: «sim, 5000 grãos é muito. Mas 4999 também já era muito».
    «E onde fica a fronteira?» perguntam. «Aos 5000 é muito, mas pouco antes também já é», responde.

    As mutações alteram o material genético, e um grão de arroz acrescenta aroz ao prato.

    Várias mutações sucessivas (não no mesmo ser, mas nos seus vários descendentes) podem criar novas funcionalidades, tal como muitos grãos de arroz podem fazer o monte de arroz passar de «pouco» para «muito».

    Se tu dizes que não, que mutações não podem criar informação, perguntam-te «o que seria nova informação?», como quem pergunta «a partir de quantos grãos é muito?».

    Geralmente esta pergunta não é respondida com rigor. Mas tu respondeste «criação de novas funcionalidades» como quem responde «5000».
    Finalmente! Uma resposta concreta.

    Eis então que te podem mostrar a criação de novas funcionalidades. Aquilo que respondes é que isso é «variação», não há «nova informação*». Como quem diz: «mas 4999 já era muito». Então que raio de resposta foi essa? Se vês uma nova funcionalidade e dizer que é variação, que não aumentou a informação, então não tens forma de dizer que aumento de informação é criação de novas funcionalidades.


    (* "bactérias dão bactérias" é como dizer: se acrescentares um só grão, não aumentam 100 no prato.
    Óbvio, mas não tem nada a ver com o que é discutido)

    ResponderEliminar
  54. Quando é que as pessoas se aperceberão que a Biblia foi escrita por homens (e não por Deus) e é completamente influenciada pelo conhecimento que havia na altura?

    Se a Biblia fosse escrita hoje, Deus teria criado o Universo com uma grande explosão há 14 biliões de anos atrás (é este o número? adiante), e tinha engenderado (lol, isto nem deve ser palavra... adiante) os mecanismos da vida para que depois de muitas pequenas alterações iria eventualmente dar aso ao ser humano. Obviamente que foi tudo planeado ao mais infimo pormenor, por um Criador omnisciente e omnipotente.

    Tentar adaptar o que foi escrito há >1000 anos atrás com o que hoje se conhece é ... fútil, na melhor das hipóteses.

    A Bíblia pode ser uma ferramenta muito útil para tirar guias espirituais, morais e essas coisas todas que afectam a vida cristã. Parem de a tentar usar como fundamento científico... por favor. É de uma desonestidade intelectual tão grande que nem consigo classificar.

    A Bíblia não tem de estar TODA correcta, nem TODA errada. Os Criacionistas afincam-se tanto ao que a Bíblia diz sobre a origem da vida porque têm medo que se se invalidar esta parte do que está escrito, tudo o resto perde também o valor. Não deviam ter esse medo.

    Os valores que a Bíblia transmite são (ou deveriam ser) mais importantes que o conhecimento. E não deixam de ter valor por o conhecimento presente na Bíblia estar desactualizado. Deixem de ter medo que o vosso livro perca valor só porque foi escrito num tempo distante. A sério.

    /rant

    ResponderEliminar
  55. João Vasco,

    O teu exemplo é muito bem conseguido, mas nada falas sobre a velocidade com que vais juntando cada bago de arroz. Lembra-te que só tens um prazo de 10 mil anos para encheres o prato com arroz. Como sabes, apesar do mundo ter a aparência de ter 14 mil milhões de anos, está escrito algures que o Universo tem apenas 10 mil... ;-)

    ResponderEliminar
  56. Sandra,

    Pois... É todo um mundo...

    ResponderEliminar
  57. Mats,

    1) O termo "discreto" é um termo matemático. Basicamente quer dizer que não pode ser mais dividido (exemplo; entre 0 e 1 não existem mais valores). O oposto é "contínuo" (entre 0 e 1 existe uma infinidade de valores: 1/2, 1/4, 1/8, etc). Nos sistemas digitais a informação é discreta (num gráfico é representada com linhas rectas ou barras). Nos sistemas analógicos é contínua (num gráfico é representa com curvas). img

    2) Exemplo: O ADN é um sistema discreto porque tem unidades de informação (bases) que podem ser adenina (A), citosina (C), guanina (G) ou timina (T). Uma mudança em uma unidade é uma mutação discreta (não pode mais pequena).

    3) Pode-se fazer um programa com uma cadeia de caracteres na memória, que representam as bases, que é copiada com pequenas alterações (mutações), simulando o que observamos na natureza. Por exemplo, fiz um programa que começa com essa cadeia: "TTCCATATGGAGTCTTTGCA" (20 bases). Em 100 alterações aleatórias (adição, subtracção, substituição, troca, inversão), obtive isto: "TTGCTCCTTTTGATTCTTCACTAA" (24 bases). Basicamente o que dizes é que é impossível que o primeiro represente um animal que não produz leite e que o último represente um que produza leite. Mas se o último representa o primeiro animal que produz leite, as características antecedentes não são de informação adicionada.

    4) Se a informação que permite a produção de leite é a mais pequena, o que permite glândulas que segregam suor não é informação nova. O ornitorrinco não tem mamilos nem segrega leite normal. O leite é um líquido gorduroso que é segregado de glândulas sebáceas (do suor). O ornitorrinco é um animal de sangue frio, é ovíparo, tem veneno semelhante aos das cobras, o genoma é muito parecido com os de répteis e o seu esqueleto é parecido com os dos sauropsidas (proto-mamíferos), que tinham pequenas escamas em certas partes do corpo. Se as glândulas mamárias são glândulas sebáceas modificadas, então, pelo que dizes, quando um animal sem nenhuma dessas glândulas tem ascendentes com glândulas sebáceas dessas glândulas, não houve aumento de informação. É isso que queres dizer?

    ResponderEliminar
  58. Já agora, duas infecções virais, do mesmo vírus, na mesma posição de genomas de duas espécies diferentes... é uma coincidência do caraças!

    ResponderEliminar
  59. João, Nuvens
    não sei se era alguma piada particular mas de qualquer maneira podem ver aqui:

    É a aplicação da lei de Gauss ao campo gravítico

    ResponderEliminar
  60. «se se encontrar o mesmo retrovirus no MESMO local nos patos, o que é que vais concluir? Que temos um parente comum com os patos?»

    Que a Teoria da Evolução estaria errada, se não houve uma coincidência gigantesca. É como perguntar o que concluiria se um pai tivesse um filho com o ADN completamente diferente - o sistema para determinar a paternalidade estaria errado. Ou como perguntares o que concluiria se encontrasse um fóssil de um ser humano onde supostamente não deviam existir mamíferos.

    Será que foram encontrados "o mesmo retrovirus no MESMO local nos patos"? Se não foram encontrados, deves é questionar-te por que é que os que existem, existem de modo a validar a Teoria da Evolução.

    ResponderEliminar
  61. Paulo Sustelo:

    Sim, era uma brincadeira, mas muitas vezes a brincar se aprende.

    Obrigado pelo link.

    Tudo começou pela bizarra ideia dos criacionistas que se ninguem viu uma familia nova surgir que isso não tenha acontecido.

    É como dizer que não esta provado que somar 11123354000 macacos a 1 macaco não dê 11123354001 porque nunca ninguém o fez. Na realidade nem nunca fará. É muito macaco, compreendes.

    Claro que somar mutações para provar que 1 mutação mais duas dão 3 mutações até é mais facil. O problema é que demora muito tempo a esperar que apareçam as mutações certas. Que eles até ja ssumiram que aparecem ocasionalmente por "benevolencia de deus". Vê o texto do Mats.

    O criacionismo é como uma arca rachada num pântano lodoso. Vai ficar para fóssil. Mas não mais.

    ResponderEliminar
  62. Pedro Amaral Couto


    HUMM
    não percebi o problema enunciado , pode tentar explicar melhor ? o do vírus do pato e do adn de cada.

    ResponderEliminar
  63. Nuvens:

    O Mats tinha e escrito: «Já deverias saber que o retrovirus não é evidência para a evolução. Deixa-me fazer uma pergunta: se se encontrar o mesmo retrovirus no MESMO local nos patos, o que é que vais concluir? Que temos um parente comum com os patos?»

    Vírus podem injectar os seus genes numa parte qualquer do ADN de um animal. Se esse animal reproduzir-se, as suas crias herdam os genes do vírus na mesma posição do ADN (evolução horizontal). Nós não somos descendentes de patos nem de macacos. Eu não sou descendente do Mats nem do Nuvens. Mas temos ascendentes de humanos em comum. Nós temos os mesmos genes de vírus que infectaram esses humanos. Os índios americanos têm os mesmos genes de vírus que mongolóides (mongóis, chineses, ...) têm nas mesmas posições, por isso os índios americanos devem ser descendentes de mongolóides. Os caucasóides não têm esses genes, por isso não devem ser descendentes de índios americanos nem de mongolóides. O Mats diz que isso está errado - os retrovírus não servem de evidência para a ancestralidade comum (que ele chama de evolução).

    Tenho de esclarecer uma coisa: obviamente que a presença dos mesmos genes de patos em humanos não refuta a Teoria da Evolução - pelo contrário. O que refutaria é para além de terem genes em comum, os patos terem genes de humanos nas mesmas posições que outras aves, répteis e peixes não têm (o Mats referia-se "o mesmo retrovirus"; nota: não existem retrovírus nos nossos ADNs - o que existem é genes de retrovírus...).

    Supondo que todas as aves e humanos têm os mesmos genes de retrovírus X na mesma posição, se só os patos e os humanos tivessem os genes de restrovírus Y na mesma posição, um deles seria descendente do outro ou ouve uma coincidência gigantesta, porque existem tantos retrovírus e imensas posições no ADN. Nesse caso o mais provável seria a Teoria da Evolução estar errada.

    O que acontece é que as injecções de ARN viral seguem padrões esperados pela Teoria da Evolução. Por exemplo, os chimpanzés e os humanos têm todos esses mesmos genes nas mesmas posições, excepto aquelas que só existem nos humanos ou só nos outros primatas. Os patos não têm esses genes que as outras aves não têm - só têm genes em comum com primatas até ao ponto em que o mesmo ancestral comum. Se tivessem, seria uma prova que refutaria a Teoria da Evolução. Portanto, a teoria é falsificável.

    Perguntei ao Mats se o género de exemplos que ele propõe realmente existem. Se não existem, propus que a questão devia ser: se os genes de retrovírus não servem de evidência para a ancestralidade comum porque é que curiosamente todos os genes nas diferentes espécies coincidem com o que se espera da Teoria da Evolução? Já agora pergunto-lhe se o Criacionismo também é falsificável e como. E agradeço os exemplos do Mats.

    ResponderEliminar
  64. Pedro:

    "Vírus podem injectar os seus genes numa parte qualquer do ADN de um animal. Se esse animal reproduzir-se, as suas crias herdam os genes do vírus na mesma posição do ADN (evolução horizontal)"

    É preciso que os retrovirus atinjam o DNA dos gametas. Não serve em qualquer parte do corpo.

    Senão era um caos completo. Isso ja aconteceu, como referes, e acontece, mas não é assim tao facil.

    ResponderEliminar
  65. João,

    se for uma alteração de uma célula da pele, claro que não é herdado...
    Supus que quando digo "alterar o ADN de um animal" entende-se que me refiro os genes que podem ser herdados (nas gâmetas - espermatozóides e óvulos), senão o cancro da pele seria uma "alteração do ADN de um animal".

    ResponderEliminar
  66. Eu sei que tu sabes. Ou pelo menos calculei, pelo resto do texto. Mas não estava muito claro.

    ResponderEliminar
  67. Para explicar com um exemplo:

    Fiz uma alteração ao meu programa. Começa com uma sequência de genes (simples) que é duplicado e cada cópia sofre uma alteração. Cada cópia é duplicada, os duplicados são alterados e assim por diante. Imprimiu isto:

    1) GGGCC
    --- 1
    1) GGGCC -> CGGCC
    2) GGGCC -> GGGGCC
    --- 2
    1) CGGCC -> GCGCC
    2) CGGCC -> CCGGC
    3) GGGGCC -> GGGGCA
    4) GGGGCC -> GTGGCC
    --- 3
    1) GCGCC -> CCGGC
    2) GCGCC -> GCGCA
    3) CCGGC -> CCCGG
    4) CCGGC -> CCGGG
    5) GGGGCA -> GGGGCCA
    6) GGGGCA -> CGGGGA
    7) GTGGCC -> GCGGTC
    8) GTGGCC -> GTTGGCC

    ResponderEliminar
  68. Começando com uma sequência maior:

    0)CGGTACGATGTGAATGAGTT
    --- 1
    1) CGGTACGATGTGAATGAGTT -> CGGTACGATGTGAATAGTT
    2) CGGTACGATGTGAATGAGTT -> CGGTACGATGTGAATGATTT
    --- 2
    1) CGGTACGATGTGAATAGTT -> CGGTACGATGTGAATAGTTT
    2) CGGTACGATGTGAATAGTT -> GGTACGATGTGAATAGTT
    3) CGGTACGATGTGAATGATTT -> CGGTACGATGTGAAATGATTT
    4) CGGTACGATGTGAATGATTT -> CGGTAACGATGTGAATGATTT
    --- 3
    1) CGGTACGATGTGAATAGTTT -> CGGTACGATGTGAATGATTT
    2) CGGTACGATGTGAATAGTTT -> CGGTACGATGTGGATAATTT
    3) GGTACGATGTGAATAGTT -> GGTACGATGTGAATAGGTT
    4) GGTACGATGTGAATAGTT -> GGTACCGATGTGAATAGTT
    5) CGGTACGATGTGAAATGATTT -> CGGAGTAAAGTGTAGCATTTT
    6) CGGTACGATGTGAAATGATTT -> CGGTACGATGTGAATGATTT
    7) CGGTAACGATGTGAATGATTT -> CGGTAACCGATGTGAATGATTT
    8) CGGTAACGATGTGAATGATTT -> CGGTAACGATGTGAATGATTTT
    --- 4
    1) CGGTACGATGTGAATGATTT -> CGGTACGATGTGTATGATTT
    2) CGGTACGATGTGAATGATTT -> GGGTACGATGTGAATGATTT
    3) CGGTACGATGTGGATAATTT -> CGGTTAATAGTGGTAGCATT
    4) CGGTACGATGTGGATAATTT -> CGGTACGATGTGGATATTT
    5) GGTACGATGTGAATAGGTT -> GGTACGATGTGAATTAGGTT
    6) GGTACGATGTGAATAGGTT -> GGTACGATGGGAATAGTTT
    7) GGTACCGATGTGAATAGTT -> GGTACCCGATGTGAATAGTT
    8) GGTACCGATGTGAATAGTT -> GGTACCGATGTGAATATT
    9) CGGAGTAAAGTGTAGCATTTT -> CGGAGGTAAAGTGTAGCATTTT
    10) CGGAGTAAAGTGTAGCATTTT -> CGGAGTAAAGCGTAGCATTTT
    11) CGGTACGATGTGAATGATTT -> CGGTATGACGTGAATGATTT
    12) CGGTACGATGTGAATGATTT -> CGGTACCATGTGAATGATTT
    13) CGGTAACCGATGTGAATGATTT -> GGTAACCGATGTGAATGATTT
    14) CGGTAACCGATGTGAATGATTT -> CGGTAACCGATGTGAATGAATTT
    15) CGGTAACGATGTGAATGATTTT -> CGGTAACCGATGTGAATGATTTT
    16) CGGTAACGATGTGAATGATTTT -> CGGAACGATGTGAATGATTTT
    --- 5
    1) CGGTACGATGTGTATGATTT -> CGGTAACGATGTGTATGATTT
    2) CGGTACGATGTGTATGATTT -> CGGTACGATGTGATGATTT
    3) GGGTACGATGTGAATGATTT -> GGGTACGATGTGAATGATTTT
    4) GGGTACGATGTGAATGATTT -> GGGTAAGCTGTGAATGATTT
    5) CGGTTAATAGTGGTAGCATT -> CGTTAATAGTGGTAGCATT
    6) CGGTTAATAGTGGTAGCATT -> CGGTTAATAGTGGTTGCAAT
    7) CGGTACGATGTGGATATTT -> CGTACGATGTGGATATTT
    8) CGGTACGATGTGGATATTT -> CGGTACGATGTGGATATCT
    9) GGTACGATGTGAATTAGGTT -> GGTACGATGTGATTAAGGTT
    10) GGTACGATGTGAATTAGGTT -> GGTAGTGTAGCAATTAGGTT
    11) GGTACGATGGGAATAGTTT -> GGTACGTGGGAATAGTTT
    12) GGTACGATGGGAATAGTTT -> GGTACGATGGAATAGTTT
    13) GGTACCCGATGTGAATAGTT -> GGTACCCGGTGTGAATAGTT
    14) GGTACCCGATGTGAATAGTT -> GGTACCGATAATGGTAGCTT
    15) GGTACCGATGTGAATATT -> GGTTACCGATGTGAATATT
    16) GGTACCGATGTGAATATT -> GGTAGCCATGTGAATATT
    17) CGGAGGTAAAGTGTAGCATTTT -> CGTAGGTAAAGTGTAGCATTGT
    18) CGGAGGTAAAGTGTAGCATTTT -> CGGAGGTAAAAGTGTAGCATTTT
    19) CGGAGTAAAGCGTAGCATTTT -> CGGGAGTAAAGCGTAGCATTTT
    20) CGGAGTAAAGCGTAGCATTTT -> CGGAGAAAGCGTAGCATTTT
    21) CGGTATGACGTGAATGATTT -> CGGTATGTCGTGAATGAATT
    22) CGGTATGACGTGAATGATTT -> CGGTATGACGTGAATGGATTT
    23) CGGTACCATGTGAATGATTT -> CGGTACCATGTGAATGGATTT
    24) CGGTACCATGTGAATGATTT -> CGGTACCATGTGATGATTT
    25) GGTAACCGATGTGAATGATTT -> GGTAACCCGATGTGAATGATTT
    26) GGTAACCGATGTGAATGATTT -> GGGTAACCGATGTGAATGATTT
    27) CGGTAACCGATGTGAATGAATTT -> CGGTAACCGAATGTGAATGAATTT
    28) CGGTAACCGATGTGAATGAATTT -> CGGTAACCGATGTGAAGGAATTT
    29) CGGTAACCGATGTGAATGATTTT -> CGGTAACCGATGTGATTTATGTA
    30) CGGTAACCGATGTGAATGATTTT -> CGGTAACCGATGCGAATGATTTT
    31) CGGAACGATGTGAATGATTTT -> CGGAACGATGTGATTGATATT
    32) CGGAACGATGTGAATGATTTT -> CGGAACGATATGAATGATTTT

    ResponderEliminar
  69. Mats,

    "Deixa-me fazer uma pergunta: se se encontrar o mesmo retrovirus no MESMO local nos patos, o que é que vais concluir? Que temos um parente comum com os patos?"

    O Pedro Amaral Couto já respondeu a isto, mas vou tentar simplificar e colocar as coisas de outra forma. Sim, a teoria da evolução diz que todos os seres vivos partilham um ancestral (mais ou menos distante). Não há indícios de que a vida tenha surgido mais do q uma vez e evoluído independentemente (o q implicaria haver espécies que não partilhariam ancestral algum). Se surgiu outras vezes, perdeu-se, desapareceu, ou ainda não foi encontrada.

    Posto isto, em relação ao DNA retroviral nos genomas das espécies prevê-se maior coincidência quanto maior for a proximidade entre as espécies (ancestral comum mais recente). E é isto que se tem observado. Os chimpanzés têm muitas dezenas de retrovirus inseridos no seu genoma, exactamente nos mesmos sítios que no genoma humano. Outras espécies também têm alguns retrovirus em comum com os humanos, mas MENOS (ancestral mais distante). Isto é EXACTAMENTE o que se previa pela teoria da evolução.

    Não sei se o genoma dos patos já foi estudado a este nível, mas pela teoria da evolução pode-se dizer que é provável que tenha de facto alguns retrovirus em comum com o genoma humano, mas MUITO MENOS que com os chimpanzés. E todos os retrovirus que tivermos em comum com os patos, também os teremos com os chimpanzés.

    Vejamos com um esquema:
    A1
    |___ Patos
    |
    |
    |
    A2
    |___Chimpanzés
    |___Humanos

    Todos os retrovirus integrados no genoma do ancestral A1 (mais antigo), serão encontrados nas 3 espécies. Humanos e chimpanzés partilham os retrovirus do A2.

    Se os humanos partilharem um (ou vários para ser ainda mais improvável) retrovirus com os patos, que não partilhem com os chimpanzés, então a teoria da evolução tem um grande problema para resolver. Igualmente se os chimpanzés tiverem retrovirus em comum com os patos, que os humanos não tenham.

    Para explicar isso pela teoria da evolução só com delecção do DNA retroviral. O que ter acontecido de forma perfeita e sem rastos, mais do que uma vez, seria altamente improvável!

    Ou seja, é possível esta coisa do DNA retroviral vir a colocar em causa a hipótese dos ancestrais comuns e a teoria da evolução. Mas até ver, bate tudo muito certinho com que o seria de prever.

    Como os dados que temos até ao momento o DNA retroviral nos nossos genomas é mais uma daquelas coisas como a luz a caminho da terra à aparentemente milhões de anos. Ou é tudo muito antigo e evoluiu lentamente, ou então o criador anda a enganar-nos. A hipótese do criador ter feito o universo à apenas uns milhares de anos, contado a verdade a um povo nómada no médio oriente, mas moldado toda a realidade para aparentar o contrário... não me parece muito convincente.

    ResponderEliminar
  70. João Vasco,

    Tu pediste um exemplo onde se veria que há informação nova. Eu dei-te um exemplo onde eu ficaria convencido que os processos naturais são capazes de gerar informação nova.

    Eu bem te disse (desde o princípio) que qualquer que fosse a minha resposta, tu nunca ficarias convencido, e isso deve-se a própria natureza da pergunta.

    Da mesma forma que vocês ateus dizem que a evolução seria refutada com a descoberta de um fóssil de coelho no pré-cambriano (nós sabemos que é falso; vocês apenas diriam que houve "contaminação" ou outra coisa do género), eu digo que se tu ou outro ateu me mostrasse um lagarto a começar a ter capacidade de produzir leite E a amamentar os seus descendentes, eu não poderia usar o argumento da informação contra a vossa teoria da evolução.

    Acho que eu não poderia ser mais claro.

    As mutações alteram o material genético, e um grão de arroz acrescenta aroz ao prato.

    "Alterar" não é sinónimo de "acrescentar"

    Várias mutações sucessivas (não no mesmo ser, mas nos seus vários descendentes) podem criar novas funcionalidades,

    Mas "novas funcionalidades" por si só não significam mais informação, como de certo já sabes.

    Se tu dizes que não, que mutações não podem criar informação, perguntam-te «o que seria nova informação?», como quem pergunta «a partir de quantos grãos é muito?».


    Nova informação seria um réptil a adquirir capacidade de amamentar os seus filhos, e que se soubesse que ele nunca tinha tido essa capacidade. Acho que não há nada de vago com isto.

    Geralmente esta pergunta não é respondida com rigor. Mas tu respondeste «criação de novas funcionalidades» como quem responde «5000».
    Eu procurei onde eu tenha escrito "criação de novas funcionalidades" e não encontrei. Podes me mostrar? Se calhar passou-me. O exemplo que eu dei é o do lagarto. A criação de novas funcionalidades nem sempre significam aumento de informação genética. Veja-se no exemplo do nylon e das bactérias.

    Eis então que te podem mostrar a criação de novas funcionalidades. Aquilo que respondes é que isso é «variação», não há «nova informação*». Como quem diz: «mas 4999 já era muito». Então que raio de resposta foi essa? Se vês uma nova funcionalidade e dizer que é variação, que não aumentou a informação, então não tens forma de dizer que aumento de informação é criação de novas funcionalidades.

    Mas eu não faço equivalência entre "aumento de informação" com "criação de novas funcionalidades".

    Um ser vivo pode muito bem ganhar capacidades novas (aquilo que tu chamas "novas funcionalidades") sem que isso envolva aumento de informação genética.
    ...
    Grassé regards the "unceasing mutations" to be "merely hereditary fluctuations around a median position; a swing to the right, a swing to the left, but no final evolutionary effect."

    ResponderEliminar
  71. Mats,

    Estive a ler o teu post sobre as bactérias e o nylon, q descobri ser baseado no artigo do Brian Thomas no site do Institute for Creation Research. Acontece que este sr. Thomas parece ter tirado alguns factos da cartola. Estive a ver o artigo cientifico que consta das referências, e outros relacionados que encontrei, e nada indica que a enzima EII antes da mutação fosse capaz de degradar proteínas circularizadas. Simplesmente não se sabe qual é a enzima precursora da EII! Estudos de cristalografia indicam que talvez tenha evoluído de uma "esterase com dobras de β-lactamase" (a família de enzimas q dá resistência à penicilina), mas que é significativamente diferente de qualquer outra enzima conhecida produzida pelas bactérias Flavobacterium ou quaisquer outras. É tão diferente que até se pensava que teria surgido por mutação "frameshift" (a inserção ou delecção de 1 nucleótido num gene, alterando radicalmente a sequência de amino-ácidos produzida). Essa hipótese parece entretanto afastada, mas só no genoma humano já foram encontrados uns 470 exemplos dessas mutações.

    O que se sabe também é que a EII consegue degradar certos derivados do nylon e NADA mais. Se foi "perda de especificação" de uma enzima anterior, foi perda total e radical. E ganhou especificação com nylon. Não é um cadeado "danificado de modo que mais chaves agora conseguem abri-lo". Quanto muito será um cadeado (aloquete cá no norte) que ficou danificado e agora abre com uma chave completamente diferente. Antes de 1935 tal mutação seria negativa com perda total de função. Mas nos efluentes da fábrica japonesa de nylon onde o Flavobacterium sp. K172 foi isolado, foi uma mutação positiva.

    Independentemente de como apareceu o gene que produz a EII, não deixa de representar nova informação e nova funcionalidade. Num património genético onde não havia nada que degradasse nylon, passou a haver. É como acrescentar uma nova chave a uma caixa de ferramentas. Mesmo que seja parecida ou derivada de outra chave já existente, não deixa de ser nova e servir para fazer algo novo.

    Mas há mais alguns detalhes interessantes nesta história. Para além da EII aquela estirpe de Flavobacterium tem, no mesmo plasmideo (um pedaço circular de DNA), genes para outras enzimas capazes de degradar oligomeros de nylon. São um total de 4 (designadas simplificadamente por EI, EII, EII' e EIII). A EII' é homologa da EII (são 88% iguais), mas tem uma actividade MUITO inferior. É um exemplo daquele mecanismo clássico citado pelos biólogos para acrescentar informação a um genoma (duplicação e mutação). Um gene é duplicado podendo sofrer mutações (positivas, negativas ou neutras) sem afectar a funcionalidade do original, garantindo assim a sobrevivência do ser vivo. Estas 4 enzimas têm todas actividades relativamente baixas, o que seria de esperar para enzimas que surgiram recentemente e ainda não tiveram tempo de sofrer optimização através de novas mutações e selecção natural.

    Em laboratório já se conseguiu que uma estirpe de Pseudomonas desenvolvesse enzimas equivalentes às EI e EII do Flavobacterium. Mas apesar da funcionalidade idêntica, as sequências de amino-ácidos das duas EII têm apenas 37% de homologia.

    ResponderEliminar
  72. Nelson,

    O truque é ainda melhor. Imagina que uma enzima é capaz de degradar 4 substratos e, por uma modificação, passa a degradar 5. Degenerou, perdendo especificidade.

    Agora imagina que é o contrário. Degradava 5 e, por mutação, passou a degradar 4. Degenerou porque perdeu funcionalidade.

    E se degradava uns e passou a degradar outros é ainda pior. Perdeu especificidade *e* perdeu funcionalidade.

    É só degeneração aconteça o que acontecer.

    ResponderEliminar
  73. Mats,

    «"Alterar" não é sinónimo de "acrescentar"»

    Se pensares na população, verás que sim, normalmente é.

    Imagina que numa população, num certo locus, existe uma distribuição dos alelos a, b e c.

    Imagina que uma mutação pontual altera, num individuo, o alelo c para um novo. Chamemos-lhe d.

    É verdade que esse indivíduo não tem mais informação genética que os seus pais. O seu genoma tem o mesmo comprimento.

    Mas a população agora tem mais informação genética, pois nessa população, nesse locus, agora há os alelos a, b, c e d.

    E se a mutação for uma inserção ou duplicação, aumenta logo a informação no genoma.

    ResponderEliminar
  74. O João Vasco aceitou o exemplo. Fez mais uma questão e fez uma observação:
    suponha que no momento X não existem lagartos que produzem leite e muito depois, num momento Y verificamos que existem lagartos que produzem leite. Entre X e Y houve aumento de informação? («Nesse caso, concluirias que algures houve um incremento de informação - que não conseguiste identitficar? - ou que explicação darias, caso visses isso?») Não foi respondida.

    Ele fez uma observação análoga à seguinte:
    imaginem que só existem animais brancos e que o clima é muito frio. Esses animais têm crias brancas, ligeiramente mais claras ou mais escuras. A temperatura com o tempo vai aumentando gradualmente, favorecendo a reprodução dos animais mais escuros. Os mais escuros têm mais crias que os outros. As crias mais escuras dessas crias têm mais crias que os outros. Repete-se e passado muito tempo praticamente todos os animais são cinzentos. Depois praticamente todos os animais são pretos.

    Em que momento surgiu o primeiro animal preto? Esta imagem ajuda a dar a resposta correcta. Cada pixel representa a cor de um animal. #8b8b8b e #7a7a7b são valores hexadecimais que representam duas cores cinzentas muito parecidas. Qual é o valor hexadecimal da primeira cor preta a contar da esquerda? E do cinzento? Não existe, tal como não existe um momento em que surgiu o primeiro animal preto. E, paradoxalmente, do lado esquerdo de um pixel preto está sempre um pixel preto. ("Imagina o desespero quando de repente ele diz: «sim, 5000 grãos é muito. Mas 4999 também já era muito». «E onde fica a fronteira?» perguntam. «Aos 5000 é muito, mas pouco antes também já é», responde.")

    Suponham que o branco representa lagartos que não produzem leite e o preto representa lagartos que produzem leite. No cinzento houve aumento de informação? É essa a pergunta do João Vasco! E não foi respondida.

    ResponderEliminar
  75. Não se sabe se houve répteis que produziam leite (as glândulas mamárias não são registadas nos fósseis), mas sabe-se que existiram animais com escamas, bigodes e esqueletos semelhantes a mamíferos e répteis: os terapsidas, como o Lemurosaurus e o Raranimus. Actualmente ainda existem mamíferos com algumas características de répteis, ovíparos, com cloaca, sem mamilos nem mamas, e com os genomas muito parecidos com os dos répteis: os monotremas - o ornitorrinco, a equidna e o opossum.

    Num comentário enganei-me ao ter dito que os ornitorrincos têm sangue-frio. Têm sangue-quente, mas é ineficiente, tal como os dos outros monotremas. Está entre os répteis de sangue-frio e a maioria dos animais de sangue quente. Mas o que interessa é o leite. Ele não é produzido em mamas e as crias não mamam. Sai pelos poros como suor, que as crias lambem, por isso julga-se que as mamas têm origem na modificação de glândulas sebáceas. Em questão de produção de leite, com a analogia do branco e do cinzento, nos ornitorrincos está no cinzento para o preto. Os outros mamíferos estão no preto e os lagartos estão no branco.

    Certamente que o Mats não daria como exemplo peixes com pulmões e que andam em terra. Eles existem actualmente, como os saltadores do lodo, o Protopterus e o peixe pulmonado de Queensland. De qualquer modo não faria diferença.

    O coelho como falsificação é só um exemplo fácil de compreender. Podia ser um humano, um macaco, um cão, uma vaca, etc. Afinal de contas, não faria diferença a ordem se fosse arbitrária. Com um dilúvio podia aparecer um humano ao lado do que seria suposto serem os primeiros dinossauros. A aposta de que se espera um padrão nos fósseis é muito arriscada se as estratificações devem-se a um dilúvio universal.

    Mas mamíferos com características de répteis e peixes com características de anfíbios nunca irão contar. Se eu for como o dos "brancos" no lado esquerdo, não espero ter um filho como dos "pretos" do lado direito, mas talvez se vivêssemos muito mais que humanos, como vemos milhares de descendências de bactérias, vejamos se os nossos ascendentes são diferentes - os humanicos -, como um ornitorrinco placentário e com mamas. Uns dirão que não houve aumento de informação e que humanicos dão humanicos. E se os monotremas e peixes pulmonados tiverem sido extintos, mamíferos ovíparos sem mamas que tivessem mamíferos plancentários com mamas, e peixes sem pulmões que tivessem peixes com pulmões serviriam de exemplos. Dou outro exemplo: um réptil com asas.

    ResponderEliminar
  76. Mats: «"Alterar" não é sinónimo de "acrescentar"»
    Ludwig: «É verdade que esse indivíduo não tem mais informação genética que os seus pais. O seu genoma tem o mesmo comprimento.»

    Ludwig, não percebeste o que o Mats queria dizer. Ele refere-se a algo subjectivo do fenótipo. Não tem a ver com o genótipo. Repara no exemplo dos lagartos que produzem leite. Os répteis modernos não têm glândulas sebáceas. É provável que répteis corredores, como o Velociraptor, tivessem, mas hoje não existem. Passarem a existirem répteis com glândulas sebáceas seria um acrescento. À priori, glândulas mamárias e mamas também seriam um acrescento, mas se fossem de uma modificação de glândulas sebáceas, poderiam dizer que foi uma alteração.

    Pensa no lagarto e na ave. Os lagartos não têm asas. Se passassem a ter, seria um acrescento. O aumento das patas dos répteis seriam apenas uma alteração. Se membranas interdigitais unissem, formando asas, seria apenas uma alteração. Se as escamas mudassem de forma, seria apenas uma alteração. Mesmo se a certa altura tornassem penas. Da pele dos répteis para as pernas escamadas das aves seria uma alteração. Podiam ter o mesmo número de genes, que seria irrelevante e se focares neles não respondes ao Mats. E, como viste, terias de refutar a Teoria da Evolução apoiando uma ideia de evolução dos criacionistas para responderes satisfatoriamente.

    ResponderEliminar
  77. Ludwig,
    E se a mutação for uma inserção ou duplicação, aumenta logo a informação no genoma.


    Se eu fizer uma fotocópia dum exame meu, e entregar ao professor, vou ter o dobro da nota no teste?

    ResponderEliminar
  78. Mats,

    «Se eu fizer uma fotocópia dum exame meu, e entregar ao professor, vou ter o dobro da nota no teste?»

    Não. Mas a quantidade de informação não tem nada que ver com o significado da mensagem.

    ResponderEliminar
  79. Mats,

    Imagina que tens um molho de chaves. Fazes uma cópia de uma delas. (Ou usas uma que já te é inútil.) Depois limas um dente aqui, outro ali, e passa a poder abrir uma fechadura nova.

    Independentemente de como chegaste a esse resultado tens nova "informação". Agora já sabes, ou tens meios para, abrir uma nova fechadura.

    É uma boa analogia do que se passou naquela estirpe de Flavobacterium em relação ao nylon.

    ResponderEliminar
  80. Ludwig:

    « Mas a quantidade de informação não tem nada que ver com o significado da mensagem. »
    Acho que não devias insistir nisto.

    Tens toda a razão, mas perdes a razão para quem percebe pouco de biologia. Na linguagem comum a quantidade de informação não depende directamente do número de letras. Podes aumentar as letras e ter pouca informação, e vice versa.
    Bem sei que na ciência existe um significado rigoroso e possível de medir para "informação", mas como é diferente do significado vago da lingagem comum, eles dão-te a volta.

    O problema é que o Mats define o significado vago: «novas funcionalidades». MAs quando surge uma nova funcionalidade, ele diz que houve perda de especificidade. Então, afinal a definição não era a que ele dizia.

    Eu acho que o objectivo deve ser faze-los definir em concreto o que querem dizer com «aumento de informação» mesmo que isso seja diferente daquilo a que os cientistas chamam «aumento de informação». A partir do momento em que eles dão uma definição concreta, ao invés de vaga, dar exemplos de como mutações podem provocar os tais «aumentos de informação» de acordo com a definição deles. Ou então a definição deles torna-se tão irrelevante que podes mostrar como uma bacéria passa a elefante sem nunca ocorrr aquuilo a que eles chamam «aumento de informação».

    Assim que eles começam a responder a perguntas, a realidade permite mostrar o seu erro.

    ResponderEliminar
  81. João Vasco,

    O truque é de facto nunca definir concretamente e adaptar conforme dá jeito. A argumentação criacionista assenta em 2 conceitos, informação e "tipos" de animais. Eles dizem que nunca veremos adição de informação aos genomas das espécies, nem animais de um "tipo" darem origem a animais de outro "tipo".

    E tenho de concordar com eles! (se eu fosse o Dawkins a dizer isto iam já tirar esta frase do contexto)

    Não é que na natureza aquelas coisas não aconteçam (sem intervenção de qualquer ser sobrenatural). Simplesmente, quando se dão exemplos eles distorcem as coisas e/ou adaptam o conceito de informação ou "tipo" conforme dá jeito.

    ResponderEliminar
  82. Mats,

    Depois dos retrovirus endógenos aqui vai outra descoberta da genética que é complicada de explicar pelo criacionismo.

    Entre os animais filogeneticamente superiores, os humanos são dos poucos que não produzem Vitamina C, tendo de a receber através da alimentação. Mas se tivemos antepassados capazes de produzir Vitamina C seria de esperar encontrar algum indicio no nosso genoma. E encontrou-se! Temos o gene incompleto da enzima necessária (GULO), inactivado por mutações.

    Até aqui os criacionistas poderiam dizer que foi parte do castigo divino após a queda (um castigo praticamente só sentido pelos marinheiros da altura dos descobrimentos), ou então uma mutação negativa ocorrida algures desde a criação do homem. Acontece que quase todos os primatas (incluindo chimpanzés, gorilas, orangotangos, gibões, macacos, etc) sofrem do mesmo. Um animal mais distante, e já estudado, com o mesmo problema é o porquinho-da-índia. Tal como se previu pela teoria da evolução, o homem e restantes primatas aparentam ter o gene GULO inactivado pela mesma mutação "frameshift". Na ausência de pressão selectiva o gene foi sofrendo mais algumas mutações ao longo do tempo. Comparado com o nosso, o gene dos chimpanzés partilha quase todas as mesmas mutações. O gene dos orangutangos difere mais um bocadinho, e dos macacos mais ainda. E tal como se previa o gene dos porquinhos-da-índia foi inactivado por uma mutação diferente.

    A probabilidade disto tudo ter acontecido por acaso é astronomicamente pequena. Mas a hipótese do antepassado comum explica tudo direitinho. Os primatas terão herdado o gene inactivado de um antepassado comum. Como partilhamos um antepassado comum mais recente com os chimpanzés, temos mais mutações em comum. Com os orangutangos temos um antepassado mais antigo, logo menos mutações em comum. E por ai fora...

    Os porquinhos-da-índia aparentam ter perdido a funcionalidade do GULO de forma independente. Os criacionistas gostam de apontar que, nos exons do gene GULO que temos em comum com os porquinhos-da-índia, 36% das lesões são idênticas. É uma coincidência curiosa e que merecerá mais estudo. Mas esquecem-se que mesmo isso sempre é MUITO mais provável do que tudo o resto ter acontecido por acaso!

    Compatibilizar isto com a história bíblica da criação é muito complicado. Se deus nos castigou após a queda retirando a capacidade de sintetizar vitamina C, também o fez na maioria dos restantes primatas (aqueles q os biologos viriam a classificar como subordem haplorrhini) provocando exactamente a mesma mutação. E manipulou ainda as mutações subsequentes de modo a não estragar a nossa ilusão de que os chimpanzés são parentes mais próximos e os orangutangos e macacos mais distantes.

    Caraças! Eu se fosse criacionista estaria muito frustrado com o criador. Não só não ajuda nada a convencer o resto mundo que o Génesis é para ser interpretado à letra, como parece ter manipulado as coisas propositadamente para aparentar o contrário! Isto é acreditar num deus que não intervém quando crianças morrem com fome, doenças ou desastres naturais, mas manipula obsessivamente a integração de DNA retroviral e mutações inúteis em genes desactivados de modo a enganar os cientistas.

    ResponderEliminar
  83. Aqui está um video que explica bem esta questão da Vitamina C:
    http://www.youtube.com/watch?v=SF2N2lbb3dk

    ResponderEliminar

Se quiser filtrar algum ou alguns comentadores consulte este post.