domingo, dezembro 14, 2008

Treta da Semana: O amor ao próximo.

A homossexualidade é crime em 86 países. Nestes, o sexo consensual entre adultos, em privado, pode levar à prisão ou até à pena de morte. Nos próximos dias a França irá propor às Nações Unidas uma declaração condenando a criminalização da homossexualidade. «Exortamos os Estados para tomar todas as medidas necessárias, em particular legislativas ou administrativas, para garantir que a orientação ou identidade sexual não possam, em circunstância alguma, servir de base a acções penais, em particular execuções ou penas de prisão.» (1)

Esta declaração conta já com o apoio de toda a Europa. Toda? Não! Um pequeno estado povoado de irredutíveis católicos ainda resiste ao avanço da decência. O Monsenhor Celestino Migliore, observador permanente da Santa Sé nas Nações Unidas, diz que apesar da Igreja Católica se opor à «discriminação injusta» dos homossexuais, uma declaração da ONU poderia pressionar os estados que não reconhecem o casamento entre homossexuais. Há que escolher, portanto, o mal menor. Mais vale deixar que metade dos países do mundo prendam e executem pessoas pela sua orientação sexual do que arriscar que outros se sintam pressionados a conceder os mesmos direitos civis a todos os casais que queiram viver uma vida em conjunto. Isso sim seria uma tragédia.

Felizmente se preservou o espírito cristão de amor ao próximo. Foi difícil, mas graças a Carlos Magno, às cruzadas, ao diálogo sempre amigável entre as várias variantes do cristianismo e à Santa Inquisição, sobreviveu até hoje esta visão do mundo que leva todos os cristãos a considerar acima de tudo a dignidade da pessoa humana em vez das politiquices e jogos de poder. Um bem haja a todos e que o vosso deus vos dê a eternidade que merecem.

1- ZNag, 12-12-08, Tell Obama, Clinton: Act Now for UN Decriminalization
Outras fontes:
Times Online, Vatican opposes de-criminalising same sex unions
Guardian, A watershed for gay rights

142 comentários:

  1. Este é mais um caso, como dizes e bem, de toda uma série de casos em que, ao longo da história, a Igreja Católica cometeu erros e mesmo crimes.

    Talvez tivesse sido melhor para a história da humanidade que a Igreja Católica não tivesse existido.

    Afinal, foi apenas por coincidência que a Europa foi e é precursora no campo dos direitos humanos.

    Na Ásia, por exemplo, só para falar de uma civilização que pouco foi contamindada pelo cristianismo, o respeito pelos direitos humanos e a inexistência da pena de morte é algo de absolutamente natural.

    ResponderEliminar
  2. Exacto, tal como os Estados Unidos! Cura-te meu...

    ResponderEliminar
  3. O problema, Ludwig, é que a maior parte dos cristãos nem sequer estão interessados no que os homosexuais fazem na privacidade dos seus quartos, mas sim na vontade destes em indoctrinar o resto da população que a homosexualidade é "tão normal" como a heterexualidade, nem que para isso eles (os homosexuais) tenham que usar intimidação, violência e tudo o mais (lê sobre a reacção deles quando souberam que os californianos votaram a favor da Proposição 8, que define casamento entre um homem e uma mulher).

    Sugiro que leias o testemunho de um homosexual sobre o que é(era?) a sua vida como homosexual, e sobre a verdadeira agenda do movimento homosexual.

    Eu sei que, para os convertidos ao darwinismo, as evidências não contam muito, mas pode ser que o testemunho pessoal mude a forma como se olha para essa práctica sexual, e a filosofia por trás dela.

    ResponderEliminar
  4. Timshel,

    «Afinal, foi apenas por coincidência que a Europa foi e é precursora no campo dos direitos humanos.»

    Não foi coincidência. Acontecimentos como a revolução francesa e a segunda guerra mundial foram determinantes nisso.

    Mas o cristianismo não me parece que tenha tido um papel fundamental nos direitos humanos como os conhecemos agora. Bem pelo contrário. O estado do vaticano é o único da europa onde a discriminação sexual e religiosa é assumida por lei e onde não há democracia nem liberdade de expressão.

    ResponderEliminar
  5. Caro Mats,

    "O problema, Ludwig, é que a maior parte dos cristãos nem sequer estão interessados no que os homosexuais fazem na privacidade dos seus quartos, mas sim na vontade destes em indoctrinar o resto da população que a homosexualidade é "tão normal" como a heterexualidade, nem que para isso eles (os homosexuais) tenham que usar intimidação, violência e tudo o mais"

    Os cristãos também não se coibem de endoutrinar o resto da população na sua perspectiva sobre o sexo, que defendem como a 'normal'. E também fazem uso da intimidação, violência e tudo mais. Qual será a mais 'normal'? (não vale a pena responderes, receio saber a resposta!).

    Daqui a 100 anos tenho quase a certeza que esta questão fará tanto sentido como a escravatura nos dias que correm. Felizmente, o tempo e finitude da vida têm concorrido para fazer desaparecer imbecilidades (e imbecis que as proferem). Digamos que evoluímos um bocadinho quando isto acontece.

    xxxxx

    ResponderEliminar
  6. Mats,

    Essa da filosofia por trás da prática sexual é engraçada :)

    Mas, já agora, porque é que dizes que a homossexualidade não é natural?

    ResponderEliminar
  7. Caros jogadores,

    A Bíblia não enquadra os homossexuais como grupo a ser particularmente repudiado ou odiado pelos cristãos. Além disso, ela não diz que Deus os punirá — nem qualquer outra de suas criaturas — queimando-os num inferno de fogo para sempre. Porém, as Escrituras de facto apresentam as normas de moral de nosso Criador, as quais muitas vezes são contrárias aos conceitos de moral da actualidade. Os actos homossexuais, o sexo heterossexual entre pessoas não-casadas e a bestialidade são práticas condenadas na Bíblia.

    ResponderEliminar
  8. Porque não acontece na natureza, só nos seres humanos.


    E em vários mamíferos.

    E em imensas especies de peixes.

    Tirando esses todos, quase não acontece na natureza.

    ResponderEliminar
  9. Ska

    Na natureza acontece tudo.

    Outra questão diferente é o que deveria ou não existir e porquê.

    ResponderEliminar
  10. Timshel,

    Então nesse caso a homosexualidade é natural e o argumento do Mats, para variar, é uma treta...

    ResponderEliminar
  11. Sim. As razões pelas quais penso que a homossexualidade é um comportamento pouco compatível com o mandamento do amor não têm nada ver com o facto de ser ou deixar de ser natural. Como disse, a homossexualidade existe na natureza. Tal como a generosidade, tal como a crueldade, tal como a vida, tal como a morte. A natureza, em si mesma, não é, do meu ponto de vista (que me parece ser o de um cristão) referência para nada.

    ResponderEliminar
  12. Mats: «Eu sei que, para os convertidos ao darwinismo, as evidências não contam muito, mas pode ser que o testemunho pessoal mude a forma como se olha para essa práctica sexual, e a filosofia por trás dela.»

    Eu sei que vais gostar desses vídeos:
    * 1
    * 2
    * 3
    * 4
    * 5
    * 6

    O sr. Mats pode descrever-nos o conteúdo dos vídeos? Já agora, explique como os homossexuais afectam-nos, ou provocam sofrimento, ou morte, para percebermos qual é o problema ético.

    ResponderEliminar
  13. Ludwig,
    "Mas, já agora, porque é que dizes que a homossexualidade não é natural?"

    Primeiro e acima de tudo, a homosexualidade não é espiritualmente natural porque vai contra o Plano de Divino para a família. No princípio Deus criou um homem e uma mulher, mostrando logo qual era o padráo. A união homosexual contradiz este padrão.

    Segundo, biologicamente falando, a estrutura complementar da anatomia do macho e da fêmea é obviamente feita para uma relação marido-mulher. Claramente, a biologia humana suporta a heterosexualidade e contradiz a homosexualidade. Se uma geração de humanos decidisse ser toda composta de homosexuais, seria o fim da espécie humana.
    A homosexualidade, para além do problems médicos e psicológicos associados a ela, é um ponto morto.

    Em termos evolutivos de "sobrevivência da espécie" (os quais tu subescreves) a homosexualidade não faz sentido nenhum. Se o propósito é "espalhar os nossoss genes", como é que se explica a homosexualidade? Donde é que vem esta noção de que um ser vivo trabalhe, não para propagar os seus genes (que requer reprodução e desde logo requer macho e fémea) mas outro fim qualquer?

    Se a homosexualidade é uma predisposição genética, então a selecção natural deveria ter eliminado essa predisposição há muito tempo atrás, como forma de manter a espécie predisposta à procriação.

    Portanto nem em termos da criação original nem em termos evolutivos a homosexualidade tem justificação.
    ...
    Reparei no outro comentário, deixa-me dizer isto: o facto de "acontecer na natureza" não quer dizer que seja o que deveria acontecer. Descrever uma coisa não é prescrever essa mesma coisa.

    Entre os leões acontece uma coisa que é revoltante. Quando um novo macho toma conta de um grupo, uma das primeiras coisas que ele faz é matar as crias do macho anterior.

    Usando a lógica do "acontece na natureza portanto é natural" posso então dizer que não há problema nenhum em um homem matar os filhos da sua nova mulher, se esses filhos forem de outro homem (casamento prévio)?

    ResponderEliminar
  14. A mão e o pénis mostram como estão feitos para a masturbação. Tal como os dedos e o clítoris. A boca e o pénis mostram como estão feitos para o sexo oral. Tal como a língua e a vagina. O ânus e o pénis também mostram como servem para o sexo anal.

    ResponderEliminar
  15. Mats,

    «Primeiro e acima de tudo, a homosexualidade não é espiritualmente natural»

    Ah, espiritualmente. OK, não digas mais.

    «Se uma geração de humanos decidisse ser toda composta de homosexuais, seria o fim da espécie humana.»

    O mesmo para o celibato. Consideras então que abster-se de ter relações sexuais é uma violação da natureza espiritual tão grave como ser homossexual?

    Já agora, conheces a expressão "caír no ridículo"?

    ResponderEliminar
  16. 1) «Um estudo científico que monitorizou o perfil sexual de 2,583 homosexuais menos jovens (publicado no Journal of Sex Research) revelou que revelou que apenas 2,7% afirmou ter tido apenas um parceiro sexual»

    Referência indicada: Paul Van de Ven et al., “A Comparative Demographic and Sexual Profile of Older Homosexually Active Men,” Journal of Sex Research 34 (1997): p. 354. Dr. Paul Van de Ven reafirmou estes resultados numa conversa privada com with Dr. Robert Gagnon on September 7, 2000.

    Encontrei a fonte: A comparative demographic and sexual profile of older homosexually active men (Journal of Sex Research, Fall, 1997 by Paul Van de Ven, Pamela Rodden, June Crawford, Susan Kippax) :
    a) «There is no way of enumerating the population of homosexually active men. Participants were necessarily volunteers. Recruitment sources included sections of the organised gay community (radio, venues, gyms, businesses, publications); places of sexual contact within, outside, and marginal to organised gay communities (gay brothels, sex shops, beats, saunas); health centres frequented by gay men; and pornography outlets

    Se fossem recrutados heterossexuais de fontes semelhantes, o que irias esperar? O estudo - como o título indica - é para comparar os homossexuais mais velhos com os mais novos. Daí: «Not unexpectedly, older men had more male sexual partners in their lifetime than younger men» (...) «For the older men, the modal range for number of male sexual partners ever was 101-500 (21.6%); 2.7% had had sex with 1 partner only» (...)

    Vamos agora aos estudos que o Mats evitou:
    * The Myth, the Math, the Sex
    «One survey, recently reported by the federal government, concluded that men had a median of seven female sex partners. Women had a median of four male sex partners. Another study, by British researchers, stated that men had 12.7 heterosexual partners in their lifetimes and women had 6.5.

    But there is just one problem, mathematicians say. It is logically impossible for heterosexual men to have more partners on average than heterosexual women. Those survey results cannot be correct.»

    ResponderEliminar
  17. Mats: «Primeiro e acima de tudo, a homosexualidade não é espiritualmente natural»
    Agora o sobrenatural passou a ser natural? Quando dizem "espiritualmente" é com o objectivo de tornar a ideia não falseável e também impossível de ser provado.

    NewScientist - Evolution myths: Natural selection cannot explain homosexuality

    ResponderEliminar
  18. Survival of genetic homosexual traits explained
    «The researchers discovered that women tend to have more children when they inherit the same - as yet unidentified - genetic factors linked to homosexuality in men. This fertility boost more than compensates for the lack of offspring fathered by gay men, and keeps the "gay" genetic factors in circulation.»

    TCHA-NAM!!! Como é aquilo das evidências científicas que são ignoradas? É que o que vou ver alguém a ignorar umas coisas.

    ResponderEliminar
  19. Bolas, lembrei-me que podia ter simplesmente respondido com uma vantagem espiritual. Assim não teria de procurar por descobertas feitas fruto de experiências científicas.

    -------------------------------------

    * An Evangelical Soap Opera Starring Ted Haggard
    Um evangélico a falhar no polígrafo?! É impossível! Deve ter havido algum problema com a máquina.
    * Ted Haggard Blames Sex Scandal on Child Abuse

    ResponderEliminar
  20. Lembrei-me de outra: o evangélico que teve relações homossexuais é casado. E tem uma filha e mais quatro filhos. Ele é a prova viva de que os homossexuais podem molhar o bico nos dois lados, e ainda ter filhos. Os evangélicos acham que ele tem sido uma má influência para os seus filhos? Agora ele diz que é 100% heterossexual.

    ResponderEliminar
  21. Ludwig,
    "«Primeiro e acima de tudo, a homosexualidade não é espiritualmente natural»

    Ah, espiritualmente. OK, não digas mais.


    Já disse.

    «Se uma geração de humanos decidisse ser toda composta de homosexuais, seria o fim da espécie humana.»

    O mesmo para o celibato. Consideras então que abster-se de ter relações sexuais é uma violação da natureza espiritual tão grave como ser homossexual?


    Repara como confundes duas coisas, e dois argumentos que foram ditos em lados diferentes (espiritual e biológico). Esse tipo de argumento pode funcionar para os convertidos à tua filosofia, mas não funciona para quem observa os factos sem os óculos naturalistas.

    A homosexualidade não é uma violação da lei de Deus porque não produz descendência. É uma violação da natureza espiritual porque vai contra o propósito original da criação da sexualidade, como manifesto no normal funcionamento da mesma na reprodução. A sexualidade, tal como Deus a criou, foi feita para a interacção entre macho e fémea, e não entre relações homogenitais.

    O celibato não é violação da lei de Deus uma vez que ao ser-se celibato não se está a violar nenhuma lei originalmente imposta por Deus à Sua criação.

    Repito um ponto que não comentaste: Biologicamente falando, a estrutura complementar da anatomia do macho e da fêmea é obviamente feita para uma relação marido-mulher. Claramente, a biologia humana suporta a heterosexualidade e contradiz a homosexualidade.

    Ou será que pensas que a anatomia humana, espepcialmente no que toca aos orgãos genitais, suporta a homosexualidade?

    Repara que eu pus esse ponto no conjunto de razões biológicas contra a homosexualidade.

    Se fosses professor de anatomia, nem quero imaginar o que é que dirias sobre a função dos orgãos reprodutores masculino e feminino.

    Segundo, como é que se explica a permanência da "gene homosexual" na composição genética humana? A selecção natural "esqueceu-se", e deixou no campo genético um gene que trabalha contra a propagação dos genes? Lá se vai a teoria do "selfish gene".

    De acordo com o mito da teoria da evolução e o materialismo, como é que explicas a homosexualidade?

    Chegaste a ler o artigo sobre o homosexual que fala da sua vida homosexual?

    Já agora, conheces a expressão "caír no ridículo"?

    Sim.

    ResponderEliminar
  22. Ludwig, se quiseres usa o que escrevi, como a descoberta em genética que indiquei, o Mats não me responde. O Sabino e o Perspectiva também não.
    Também pode-se dar uma vista de olhos a isto para inspiração.

    «mas não funciona para quem observa os factos sem os óculos naturalistas.»
    Mas que factos?! Que um livro dito sagrado diz algo e que o pénis cabe num buraco? Uau!

    ResponderEliminar
  23. Vide um ânus. Agora uma vagina.

    Sexo vaginal: «O Sexo vaginal é a penetração do pênis na vagina, propiciando ao mesmo tempo o prazer mútuo para o casal e/ou a possibilidade de procriação.»

    Sexo anal: «O sexo anal» (...) «é uma prática sexual que se caracteriza pela introdução do pênis no interior do ânus do parceiro sexual, seja ele mulher ou homem. Entre humanos, tal prática é tida como uma forma de se obter prazer durante a relação sexual para satisfação de um ou ambos os participantes.»

    Se tiveres dúvidas, olha para os desenhos. Já disseste que é a parte anatómica, não a reprodutiva, que interessa, não é?

    ResponderEliminar
  24. Mats, deus também criou o homem e a ovelha, definindo assim o padrão?

    "Se uma geração de humanos decidisse ser toda composta de homosexuais, seria o fim da espécie humana. "

    Na verdade, bem longe disso. Apenas se separaria reprodução de sexo.

    "O celibato não é violação da lei de Deus uma vez que ao ser-se celibato não se está a violar nenhuma lei originalmente imposta por Deus à Sua criação"

    A lei de deus não dizia "crescei e multiplicai-vos?"

    Abandonaste o argumento perdido do "anti-natural", porque eu te mostrei que acontece na natureza? Essa dos leões é só estúpida; podes dizer que matar alguém é mau, errado, condenável ou não sei quê, mas não é por isso que passa a ser antinatural

    ResponderEliminar
  25. Nada nesta notícia me surpreende. A igreja católica é extremamente conservadora, e não tolerará a homossexualidade tão cedo. Não concordo que assim seja, mas compreendo os motivos que a levam a não apoiar esta proposta, e até faz algum sentido (tendo em mente os interesses da igreja).

    Caso apoiasse esta proposta, tal poderia ser interpretado como um apoio por parte da igreja à homossexualidade. Isto poderia levar ao surgimento de várias vozes, com base cristã, a defender a homossexualidade (todos nós sabemos o quão imaginativos podem ser os padres. Há os que cantam missas, os que emitem missas pela internet, etc). Por muito que a igreja reiterasse a sua condenação à homossexualidade, este apoio a esta proposta seria sempre visto como um consentimento à mesma. E se há movimentos de origem católica a apoiarem a homossexualidade, haverá cristãos a deixar de a discriminar e a passarem a tolera-la. Tal poderia levar a que, em alguns cenários, leis a permitir casamentos entre pessoas do mesmo sexo fossem aprovadas.

    Sei que é uma ligação um pouco ténue, mas parece-me existir. Claro que não ponho em causa as verdadeiras motivações da igreja em não apoiar esta proposta: são contra a homossexualidade, e assim ainda se matam uns quantos de vez em quando. Mas afirmar isto em praça pública seria inconveniente para os senhores, como tal arranja-se a “next best thing”.

    De resto, nada há de surpreendente aqui. A igreja continua igual a si mesma, fechada sobre si mesma, e a catalogar tudo o que é diferente como caminho para o inferno. Fora com os homossexuais, abortos, preservativos, etc etc etc

    ResponderEliminar
  26. Pedro Ferreira15/12/08, 08:38

    Mats,

    "Segundo, biologicamente falando, a estrutura complementar da anatomia do macho e da fêmea é obviamente feita para uma relação marido-mulher."

    Biologicamente falando, há espaço para, numa relação marido-mulher, existir sexo oral e / ou anal? Ou é também contra o propósito da sexualidade?

    ResponderEliminar
  27. A noção de que Deus criou o homem e a mulher tem grandes implicações para a compreensão do matrimónio.

    A noção de que toda a criação está corrompida pelo pecado, tem grande importância para se compreender os desvios que todos cometemos relativamente à Lei de Deus.

    Mas o criacionismo, porque corresponde à verdade dos factos, pode ser defendido com sucesso com base apenas em argumentos científicos.


    Na base dos argumentos científicos a favor do criacionismo encontramos um raciocínio com a forma de uma forquilha tridente:


    1) Sempre que num sistema temos informação codificada esta tem sempre origem inteligente;

    2) No DNA encontramos informação codificada;

    3) Logo, na origem da informação codificada do DNA está um ser inteligente.

    A força deste argumento é que as premissas 1) e 2) são cientificamente irrefutáveis.

    Elas baseiam-se na observação, não podendo ser desmentidas através da observação. Elas dizem respeito a factos observáveis.

    Elas colocam os evolucionistas em xeque mate, na medida em que não existe nenhuma evidência científica que as possa contrariar.

    Na origem da informação codificada em livros, enciclopédias, computadores, telemóveis, etc., está sempre uma inteligência.

    Como o Ludwig sabe isso, a sua estratégia tem sido tentar negar que no DNA encontramos informação codificada.

    No entanto, essa estratégia falha completamente, pelo simples facto de que no DNA encontramos realmente informação codirficada.

    Isso não é simplesmente um modelo de construção humana.

    É literalmente assim.

    Sequências de nucleótidos são usadas para representar toda a informação (de que a comunidade científica não dispõe) que representa todas as instruções químicas necessárias à produção e reprodução de seres vivos extremamente diversos, complexos e funcionais.

    As letras ATCG são as mesmas. O que muda é a sequência.

    Que isso é assim, é amplamente corroborado pela comunidade científica.

    Isto tem sido reconhecido mesmo pelos evolucionistas mais impenitentes.

    Carl Sagan é um bom exemplo. Ele referia-se ao DNA como “o livro da vida”, reconhecendo que a dupla hélice do DNA é a linguagem, com apenas quatro letras, em que a vida está escrita.

    A variação destas quatro letras é aparentemente infinita.

    Com elas pode ser codificada toda a informação necessária à produção e reprodução dos diferentes seres vivos.

    No que toca aos seres humanos, reconhecia Carl Sagan, o material hereditário requer múltiplos biliões de bits de informação, numa estimativa que hoje se sabe que foi feita muito por baixo.

    Nas palavras de Carl Sagan, "(these) bits of information in the encyclopedia of life-in the nucleus of each of our cells-if written out in, say English, would fill a thousand volumes. Every one of your hundred trillion cells contains a complete library of instructions on how to make every part of you."

    [Carl Sagan, COSMOS, Ballantine Books, 1980, p. 227.]

    O Ludwig diz que no DNA não existe informação codificada.

    Em sentido oposto, Carl Sagan diz que as nossas células contêm uma completa biblioteca com instruções sobre como fazer cada parte de nós (instruções essas que a comunidade científica não consegue abarcar).

    Os criacionistas não poderiam concordar mais com Carl Sagan neste ponto, já que os factos são indesmentíveis.

    Como se vê, a estratégia do Ludwig está votada ao fracasso.

    O Ludwig não tem, por isso, qualquer hipótese científica séria contra a forquilha criacionista.

    Quase podemos dizer, em tom de brincadeira, que espetámos o Ludwig com ela e agora vamos grelhá-lo no seu próprio blogue.

    Recordemos, numa formulação ligeiramente diferente:

    1) Toda a informação codificada tem origem inteligente.

    2) No DNA encontramos informação codificada em quantidade, qualidade, variedade, complexidade e densidade que transcende tudo o que a comunidade científica é capaz de produzir

    3) Na origem do DNA encontramos uma inteligência que transcende a inteligência de toda a comunidade científica junta.

    É tão simples como 2 + 2 = 4

    O Ludwig não tem qualquer hipótese científica contra este argumento. Nem ele, nem ninguém.

    Este argumento, sendo aparentemente simples, tem implicações fundamentais para a análise do big bang, da origem da vida, do ancestral comum, da selecção natural, da especiação, etc.

    ResponderEliminar
  28. A definição objectiva de aumento de informação é que continua sem ser postada, por mais que eu peça a Deus, hã?
    Haja paciência, haja fé!

    ResponderEliminar
  29. Mats,

    «Ou será que pensas que a anatomia humana, espepcialmente no que toca aos orgãos genitais, suporta a homosexualidade?»

    Claro que sim. Se não suportasse não havia homossexualidade.

    Se me disseres que a nossa anatomia não suporta as relações sexuais com formigas concordo. Há razões biológicas para concluir que isso não dá. Mas para a homossexualidade não há problema.

    ResponderEliminar
  30. Pedro Ferreira15/12/08, 09:56

    Este perspectiva é um senhor!!!!

    A técnica usada por ele é já conhecida e é a mesma que a das "Guerras Púnicas".

    Certo estudante sabia bastante sobre guerras púnicas e nada sobre tudo o resto. Quando, num teste de história, apareceu uma pergunta sobre a revolução francesa, a sua resposta foi imediata: "A Revolução Francesa foi muito importante. Mas nada que se compare com as Guerras Púnicas. Porque as Guerras Púnicas, bla, bla, bla..."

    Qualquer que seja o tema, aí está ele a falar sobre código, DNA e informação. Fala-se de homossexualidade logo código, DNA, informação.

    Perspectiva, se eu lhe falar sobre batatas fritas com sabor a presunto, aposto que vai fazer uma ligação directa ao tema código-DNA-informação, certo?

    Já que gosta tanto do tema, como é que define objectivamente aumento de informação?

    ResponderEliminar
  31. Mats:

    "ou então explica como sistemas de informação codificada aparecem por si só, sem intervenção inteligente"

    Proponho que leias os livros do Dawkins. :p

    A natureza é maravilhosa não é? A dificuldade actual (face aos factos acumulados ao lonfo de seculos de estudos) é dizer onde houve intervenção inteligente e consciente na elaboração desse processo de replicação a que tu chamas de informação codificada.

    Boa sorte.

    ResponderEliminar
  32. Perspectiva,

    Como defines objectivamente o aumento de informação?

    ResponderEliminar
  33. Mário Miguel15/12/08, 14:27

    Mats,

    A homossexualidade não natural?! Nesse caso, no teu ponto de vista, toda a tecnologia do homem, que o próprio usufrui: medicina, comunicações, cultura, e todo o conforto e qualidade de vida que daí resulta, tudo isto terá que ser renunciado. Ai de ti quando tiveres uma doença Natural fores ao médico usar técnicas que têm em conta conceitos evolucionistas para serem administrados (tomar sem interrupções até ao fim mesmo que os efeitos passem), como o Antibiótico, terás que seguir o Natural. Moço, voltai para a idade anterior à da pedra.

    ResponderEliminar
  34. Pedro Ferreira pergunta:

    "Já que gosta tanto do tema, como é que define objectivamente aumento de informação?"

    Os criacionistas perguntam: como é que se aumenta objectivamente a informação codificada num telemóvel, num computador ou numa ATM?

    A resposta que o Pedro der, se estiver certa para estes sistemas, também estará sempre certa para o DNA.

    ResponderEliminar
  35. A forquilha criacionista que vai espetar e grelhar o Ludwig (em tom de brincadeira) diz:

    1) Toda a informação codificada tem origem inteligente;

    2) O DNA tem informação codificada em quantidade e qualidade inabarcável;

    3) Logo, o DNA tem origem inteligente.

    O problema que este raciocínio coloca para o Ludwig, é que é impossível refutar as premissas a) e b) cientificamente.

    A estratégia do Ludwig tem sido a de negar a evidência e dizer que o DNA não contém informação codificada.

    Mas é claro que isso é impossível, porque o DNA contém mesmo informação codificada.

    Já vimos que Carl Sagan reconhece isso, mas podemos dar muitos outros exemplos.

    Vejamos uma pequena citação do site All about Science, que não é criacionista, onde se reconhece que o DNA contém informação codificada em quantidade e qualidade inabarcável, exactamente como os criacionistas dizem:

    Leiam devagar e com calma:

    "The DNA code, like a floppy disk of binary code, is quite simple in its basic paired structure.

    However, it's the sequencing and functioning of that code that's enormously complex.

    Through recent technologies like x-ray crystallography, we now know that the cell is not a "blob of protoplasm", but rather a microscopic marvel that is more complex than the space shuttle.

    The cell is very complicated, using vast numbers of phenomenally precise DNA instructions to control its every function.

    Although DNA code is remarkably complex, it's the information translation system connected to that code that really baffles science.

    Like any language, letters and words mean nothing outside the language convention used to give those letters and words meaning.

    This is modern information theory at its core."

    http://www.allaboutscience.org/dNA-double-helix.htm

    Um criacionista não diria melhor, nem é possível dizer outra coisa. As coisas são como são.


    Ou seja, o Ludwig pura e simplesmente não consegue dizer, no pleno uso das suas faculdades mentais, que o DNA não tem informação codificada.

    Também não consegue refutar a noção de que sempre que existe informação codificada a mesma tem uma origem inteligente.

    Daí que a forquilha criacionista vá mesmo espetar e grelhar o Ludwig Krippahl aqui, no seu blogue, perante a curiosidade dos passantes.

    Teimoso como é, o Ludwig vai certamente espernear.

    Mas, como veremos, não conseguirá fazer mais do que isso.

    ResponderEliminar
  36. «Os criacionistas perguntam: como é que se aumenta objectivamente a informação codificada num telemóvel, num computador ou numa ATM?»

    Não somos nós que afirmamos que a operação X não aumenta a informação.

    A afirmação é proposta pelo perspectiva, pelo que é o perspectiva que deve esclarecer o significado dos termos que usa.

    A não ser que admita falar daquilo que não sabe. Já todos percebemos que é o caso, mas continuaremos a demonstrá-lo com esta pergunta enquanto o Perspectiva insistir em falar daquilo que comprovadamete não percebe.

    ResponderEliminar
  37. Por isso:

    Qual a sua definição objectiva para aumento de informação?

    ResponderEliminar
  38. Este comentário foi removido pelo autor.

    ResponderEliminar
  39. Timshel,

    O Ludwig estava a responder ao argumento do Mats segundo o qual a homossexualidade não é natural.
    O argumento é treta porque a homossexualidade é natural - acontece nos animais.

    O argumento não pretende afirmar que a homossexualidade é boa por ser natural. Pretende afirmar que é ridículo defender que é má por não ser natural, nem que mais não seja por estar provado que é natural - nem é preciso ir mais longe.

    Mas apesar de tudo este equívoco atiçou a minha curiosidade: pensas que a homossexualidade é nefasta? O que pensas sobre este assunto?

    ResponderEliminar
  40. A forquilha criacionista vai mesmo funcionar, na medida em que é impossível refutar que:

    a) toda a informação codificada tem origem inteligente

    b) o DNA tem informação codificada.

    c) Logo, o DNA tem origem inteligente.


    Vejamos mais evidência empírica no sentido da premissa b).

    A fonte é a revista Nature. Leiam com atenção e com calma, para verem a insustentabilidade da posição do Ludwig:

    "That DNA contained at least one code was realized as soon as the molecule's structure was discovered.

    That code, cracked in the 1950s and 1960s, parses passages of DNA into three-letter combinations that correspond to particular amino acids.

    This is a code in the strictest sense; input determines output.

    But researchers now know that there are numerous other layers of biological information in DNA, interspersed between, or superimposed on, the passages written in the triplet code.

    Human DNA contains tissue-specific information that instructs brain or muscle cells to produce the suite of proteins that make them brain or muscle cells."

    Mais adiante continua-se:

    "The DNA sequence contains information not just about the make-up of proteins but also about the interactions of DNA with some of those proteins, and the diverse antics of RNA.

    The analysis of DNA sequences is revealing patterns that have meanings at all of these levels."


    http://www.nature.com/nature/journal/v444/n7117/full/444259a.html

    ResponderEliminar
  41. Sobre os aumentos de informação:

    Em qualquer sistema de informação codificada, os aumentos de informação só são possíveis mediante a introdução inteligente de símbolos que o código (previamente estabelecido por uma inteligência) reconheça, e aos quais faça corresponder um significado.

    Isso é assim para a informação num computador, numa ATM, num computador, ou no DNA.

    Alguns evolucionistas dizem que os criacionistas falam do que não sabem.

    No entanto, também eles vao grelhar na forquilha criacionista.

    Ela diz, de forma que é impossível de refutar com base em observações ou experiências científicas:

    1) Toda a informção codificada tem sempre origem inteligente;

    2) o DNA tem informação codificada;

    3)Logo, o DNA teve uma origem inteligente.

    ResponderEliminar
  42. "Qualquer que seja o tema, aí está ele a falar sobre código, DNA e informação. Fala-se de homossexualidade logo código, DNA, informação."

    Tudo tem que ver com tudo. Como Deus criou o homem e a mulher e estabeleceu o matrimónio, o ser humano não deixará de sofrer as consequências sempre que estabelecer algo diferente.

    No entanto, a Bíblia fala da corrupção física e moral da natureza posterior à queda no pecado.

    ResponderEliminar
  43. Ludwig,
    Tal como eu escrevi numa resposta anterior, o facto de algo acontece no mundo natural não é evidência para a sua normalidade.
    As nossas mãos podem ser boas armas para apertar os pescoços de outros humanos. Como isso acontece, segundo a tua filosofia, isso é normal, natural e recomenda-se, certo?

    Ocorrência não é prescrição.

    ResponderEliminar
  44. Pedro Ferreira15/12/08, 15:50

    Perspectiva,

    Quanto ao aumento de informação, fiquei sem perceber o que entende, objectivamente, por aumento de informação.

    "Como Deus criou o homem e a mulher e estabeleceu o matrimónio, o ser humano não deixará de sofrer as consequências sempre que estabelecer algo diferente. "

    Qual são as consequências divinas do celibato estabelecido por uma qualquer instituição? (Leia-se "celibato" como algo diferente ao matrimónio...)

    ResponderEliminar
  45. Mais evidência de que é falsa a ideia do Ludwig de que o DNA não tem informação codificada.

    Referiando o DNA diz-se:

    "These four bases are the foundation of the genetic code. Sometimes represented as T, C, A, and G, these chemicals act as the cell's memory, instructing it on how to synthesize enzymes and other proteins.

    These four nucleotides encode everything an organism needs to live and protects this information with incredible accuracy.

    In a human being, each cell holds 46 separate DNA molecules, each containing, on the average, about 160 million nucleotide pairs, yet this massive amount of information is stored and replicated almost flawlessly."

    http://library.thinkquest.org/20465/DNAstruct.html


    Também por aqui se manifesta a validade da forquilha criacionista que (em tom de brincadeira) vai espetar e grelhar o Ludwig.

    Não existe nenhuma observação ou experiência científica que permita a sua refutação.

    Vejamos:

    1) Toda a informação codificada tem origem inteligente;

    2) O DNA tem informação codificada;

    3) Logo, o DNA teve uma origem inteligente.

    ResponderEliminar
  46. Pedro Ferreira diz:

    "Qual são as consequências divinas do celibato estabelecido por uma qualquer instituição? (Leia-se "celibato" como algo diferente ao matrimónio...)"

    Boa pergunta. Em Génesis diz-se que não é bom que o homem esteja só.

    No entanto, numa sociedade decaída, nunca se diz que as pessoas tenham obrigação de casar.

    Também é verdade que a Bíblia, no Novo Testamento, nunca impos o celibato aos discípulos.

    Pelo contrário, refere-se que alguns discípulos eram casados e autoriza-se expressamente o casamento dos bispos e dos diáconos.

    ResponderEliminar
  47. Perspectiva

    A sua explicação sobre aumento de informação é uma treta :-)

    Em qualquer sistema electrónico o aumento da informação faz-se apenas pelo aumento "físico" da capacidade de manipular dois símbolos (armazenamento e velocidade de processamento): 0 e 1, Verdade e Falso, Aberto e Fechado, o que quiser.

    Com estes dois símbolos faz tudo o que quiser e mais um par de botas.

    Tudo, mas mesmo tudo o que fizer em sistemas digitais é transformado em código binário. O único que os processadores manipulam.

    É elementar meu caro perspectiva, é a simples lógica binária.

    Portanto andou semanas a matutar numa resposta à pergunta. De repente grita Eureka, já me safei desta, e sai com uma não resposta sobre semelhanças informáticas.

    Só que o que diz não faz sentido porque: ou há aumento de informação sem "introdução inteligente de símbolos" ou nunca houve aumento de informação nos sistemas digitais: computadores, atms, etc., já que não existem sistemas que trabalhem com mais que dois símbolos directos: ou passa uma determinada voltagem ou não passa nada, e é assim que a máquina “pensa”. Por muito complexa que seja a linguagem de programação, ela é sempre traduzida na linguagem da máquina. (Um bom exemplo de como algo supersimples, dois estados, pode originar algo extremamente complexo). E isto apenas aumentando o tamanho (ou seja a repetição dos símbolos base).

    Descalce lá esta bota que eu fico à espera.

    PS. Apenas porque é relevante para a pergunta que fez aos informáticos, sou analista de sistemas há vinte anos.

    Joaquim Coelho

    ResponderEliminar
  48. Perspectiva:

    O facto de ter falado SOBRE aumento de informação sem (novamente) ter respondido `pergunta feita - o que é - apenas confirma a acusação que fiz: o perspectiva fala sobre o que não sabe.

    Fala, fala e fala, mas não sabe sobre o quê. A prova é que não responde à pergunta:

    "Como define, objectivamente, aumento de informação?"

    Tudo o que disser sobre estes assuntos deve ser ignorado enquanto não responder a esta pergunta. Como se pode disutir com alguém que não sabe sobre o que é que fala?

    ResponderEliminar
  49. OU! Perspectiva, estás aí? Currupaco dá o pé louro?

    "1) Toda a informação codificada tem origem inteligente;

    2) O DNA tem informação codificada em quantidade e qualidade inabarcável;

    3) Logo, o DNA tem origem inteligente."

    Já te respondi a esta imbecilidade. Que por acaso puseste nem há 48 horas atrás num outro post. Sofres de alzheimer? Esqueces-te de que já falaste e repetes o que disseste?

    1) O cocó cheira mal

    2) O perspectiva tem cocó

    3) O perspectiva cheira mal?

    ResponderEliminar
  50. Mats,

    Ao contrário do que dás a entender, ninguém defende que a homossexualidade não é má por ser natural.
    Apenas que é ridículo afirmar que é má por não ser natural.

    A homossexualidade não é má pela simples razão de que ninguém é prejudicado. A homofobia é que prejudica pessoas, e portanto é má.

    ResponderEliminar
  51. Mário Miguel15/12/08, 16:23

    E a bissexualidade, que engloba sexos do mesmo género em prática sexuais, já não incluem o problema focado aqui de findar a espécie, não está fora do Natural, e anatomicamente funciona, sendo prazenteiro para os praticantes. Então que mal terá no ponto de vista do Mats e do Timshel?

    ResponderEliminar
  52. Pelos termos que usa, o SKA revela a qualidade dos seus pensamentos. Fica-se com a ideia de que o cérebro do SKA é constituído por intestino grosso.


    O Ludwig vai certamente grelhar na forquilha criacionista:

    1) Toda a informação codificada tem origem inteligente (não se conhece informação codificada sem uma origem inteligente)

    2) o DNA tem informação codificada (realidade impossível de negar)

    3) Logo, o DNA teve uma origem inteligente.


    O Ludwig diz que o DNA não tem informação codificada.

    Já vimos que isso é um disparate.


    O próprio Richard Dawkins reconhece que o DNA tem informação codificada:

    "DNA carries information in a very computer-like way, and we can measure the genome's capacity in bits too, if we wish.

    DNA doesn't use a binary code, but a quaternary one.

    Whereas the unit of information in the computer is a 1 or a 0, the unit in DNA can be T, A, C or G."

    ResponderEliminar
  53. "Em qualquer sistema electrónico o aumento da informação faz-se apenas pelo aumento "físico" da capacidade de manipular dois símbolos (armazenamento e velocidade de processamento): 0 e 1, Verdade e Falso, Aberto e Fechado, o que quiser."

    Existe algum sistema electrónico sem inteligência e código?

    ResponderEliminar
  54. Pedro Ferreira15/12/08, 16:30

    Joaquim Coelho,

    Provavelmente não leu alguns comentários anteriores (não o censuro pois normalmente são uns lençóis enormes...)

    O perspectiva já "descalçou" esta bota. Há uns posts atrás, ele comentava que, se bem me recordo, se numa determinada sequência, que até pode ser de dois símbolos apenas, houver alguma "inteligência" que à sequência "010", adicione "111", então houve aumento de informação (perspectiva, corrija-me se estiver errado...). Segundo ele, tem de haver código, símbolo e a interacção com alguma forma de inteligência. Logo, a squência "010111" tem mais informação que "111".

    A minha questão é que, caso haja um processo completamente aleatório que adicione "111" à sequência "010", como não houve interação de inteligência, a sequência "010111" tem a mesma informação que "010".

    Resumindo, a sequência "010111" tanto pode ter como pode não ter mais informação do que "010". Simples e objectivo, certo? :)

    Esta foi a resposta mais "objectiva" que vi do perspectiva e que demonstra aquilo que eu suspeitava. Caso corrobore uma crença, há aumento de informação; caso não corrobore, não há aumento de informação. É à vontade do freguês...

    ResponderEliminar
  55. Mas porque é que o perspectiva insite em falar em informação, se a sua incapaidade para responder à pergunta tantas vezes repetida demonstra que não sabe do que é que fala?

    Mais valia não se desviar do tema do post para falar sobre um assunto acerca do qual continua a mostrar-se totalmente ignorante, sem ser sequer capaz de esclarecer o significado dos termos que usa - de compreender aquilo que ele próprio propõe.

    ResponderEliminar
  56. Pedro Ferreira15/12/08, 16:35

    Mário Miguel,

    Para além do que dizes, segundo a mesma teoria da "funcionalidade anatómica", entre marido e mulher não pode haver sexo oral e / ou anal. Não sei, mas provavelmente estas práticas são também pecaminosas... :)

    ResponderEliminar
  57. JCoelho diz:


    "Por muito complexa que seja a linguagem de programação, ela é sempre traduzida na linguagem da máquina."

    Em todo o caso, uma operação que não dispensa inteligência e informação.

    A informação não se confunde com energia.

    (Um bom exemplo de como algo supersimples, dois estados, pode originar algo extremamente complexo).

    Só se existir informação e inteligência que dirijam o processo.

    E isto apenas aumentando o tamanho (ou seja a repetição dos símbolos base)."

    A verdade continua a ser esta:

    1) sempre que existe informação codificada, existe inteligência.

    2) o DNA contém informação codificada;

    3) O DNA teve uma origem inteligente.

    ResponderEliminar
  58. Pedro Ferreira15/12/08, 16:39

    João Vasco,

    "Mais valia não se desviar do tema do post[...]"

    O perspectiva não está a desviar o tema do post porque, como ele disse atrás, "tudo tem a ver com tudo". É a tal cena das Guerras Púnicas... :)

    ResponderEliminar
  59. João Vasco diz:

    "Mais valia não se desviar do tema do post para falar sobre um assunto acerca do qual continua a mostrar-se totalmente ignorante, sem ser sequer capaz de esclarecer o significado dos termos que usa - de compreender aquilo que ele próprio propõe."

    Se é assim tão sábio, basta demonstrar que:

    1) A informação codificada por existir sem inteligência;

    2) Ou que no DNA não existe informação codificada.

    É tão simples como isso.

    Como não o consegue fazer, porque não existe nenhuma evidência para isso, podemos afirmar com certeza:

    1) Toda a informação codificada supõe uma origem inteligente;

    2) O DNA tem informação codificada;

    3) Logo, o DNA só pode ter tido uma origem inteligente.

    É nesta forquilha que a teoria da evolução vai grelhar.

    ResponderEliminar
  60. Pedro Ferreira15/12/08, 16:41

    (off topic)

    A última "VERIFICAÇÃO DE PALAVRAS" que tive de colocar para submeter um comentário foi "broche" que, segundo a teoria da "finalidade anatómica", deverá ser pecado, mesmo entre marido e mulher... :)

    Agora a palavra é "laxic"...

    ResponderEliminar
  61. Se a informação é uma realidade imaterial, a mesma só pode ter tido uma origem imaterial.

    É por isso que sempre que para aumentar as funções de um telemóvel, de um computador ou de uma ATM é necessário aumentar a informação.

    Para isso tem sempre que existir, na origem dessa informação, uma inteligencia.

    Assim, a informação contida no DNA nunca poderia aumentar por mutações ou acidentes de cópia.

    Estes aumentam o ruído, não a informação.

    Continua a ter toda a validade a forquilha criacionista, que grelha o evolucionismo:

    1) toda a informação codificada tem sempre na origem uma inteligência;

    2) o DNA tem informação codificada;

    3) Logo, o DNA teve uma origem inteligente.


    Até agora, os evolucionistas limitaram-se a espernear, como se esperava. Mas já começaram a grelhar.

    ResponderEliminar
  62. Pedro Ferreira15/12/08, 16:45

    Perspectiva,

    Já repetiu ad naseum esse silogismo. Tenho um também para si que gostaria que provasse como falsas as suas premissas:

    1) O perspectiva não sabe dar uma definição objectiva de aumento de informação;

    2) O perspectiva está constatemente a falar de aumento de informação;

    3) Logo, o perspectiva fala, fala, fala, mas não sabe o que diz.

    Sugestão: Para provar que a primeira premissa é falsa, diga lá, objectivamente, o que é que entende por aumento de informação.

    ResponderEliminar
  63. Perspectiva:

    «Se é assim tão sábio, basta demonstrar que: »

    Mas o perspectiva não iria compreender a demonstração, visto que está a falar sobre assuntos que não entende, e a fazer afirmaões que não percebe.

    A prova é que não é capaz de responder à pergunta "Como define, objectivamente, aumento de informação?".

    Enquanto não responder a isto vale pouco a pena falar consigo sobre estes assuntos. O Perspectiva nem sequer entende aquilo que diz. Mas finge que entende. Ao não responder a esta pergunta ou desviar-se dela a careca fica visível. Trata-se de uma fraude.

    ResponderEliminar
  64. Pedro Coelho

    Se não existir qualquer código, podemos dizer que uma sopa de letras tem mais informação do que E = mc^2.

    Sequências de símbolos não valem nada sem código. De resto, uma coisa só é símbolo se uma inteligência lhe adscrever valor simbólico.

    Para saber que 1 = um e 2 = dois é necessário um código e uma inteligência.

    Continua a ser verdade que:

    1) toda a informação codificada tem sempre origem inteligente;

    2) O DNA tem informação codificada;

    3) Logo, o DNA teve origem inteligente;

    4) Logo, as mutações aumentam o ruído, não a informação.

    E os evolucionistas continua a grelhar

    ResponderEliminar
  65. O João Vasco continua a espernear.
    Mas não faz mais do que isso.

    A verdade é que a forquilha já o espetou e ele está a grelhar.

    a) toda a informação codificada tem origem inteligente.

    b) o DNA tem informação codificada;

    c) o DNA teve uma origem inteligente;

    d) as mutações aumentam o ruído, não a informação;

    e) o ruído diminui sempre a quantidade e a qualidade da informação;

    f) um aumento do ruído é um aumento da entropia

    g) a entropia é uma diminuição irreversível da quantidade e qualidade da informação;

    h) é impossível obter aumentos de informação a partir de aumentos de ruído;

    ResponderEliminar
  66. Pedro Ferreira15/12/08, 16:57

    Perspectiva,

    "E os evolucionistas continua a grelhar."

    :)

    Agora mais a sério...

    Numeração binária. Todos sabemos interpretar esse código. A sequência "010" tem mais informação "01"?

    Tente responder sabendo que o último zero da sequência foi adicionado por um humano. Agora faça o mesmo sabendo que foi adicionado por um processo aleatório.

    PS: A interpretação da sequência "010" é a usual em numeração binária.

    ResponderEliminar
  67. «Sequências de símbolos não valem nada sem código.»

    Tal como as palavras valem pouco quando não se sabe sobre o que é que se fala?

    ResponderEliminar
  68. «h) é impossível obter aumentos de informação a partir de aumentos de ruído;»

    Como é que alguém que não sabe o que é um aumento de informação pode fazer uma afirmação destas?

    «Há uma coisa que eu não sei o que é, mas acho que é impossível, e vou afirmar-lo como uma certeza, para que não descubram que não sei do que falo»

    Só que nós já descobrimos. O perspectiva continua a falar em aumentos de informaçao e não sabe o que isso é. Já viu como isso é ridículo?

    ResponderEliminar
  69. O Pedro Ferreira está a grelhar. Ele parece não saber como se aumenta a informação. Mas se ele sabe escrever, ele sabe como se aumenta a informãção.

    Ora, se ele sabe escrever, sabe aumentar a informação codificada numa página em branco.

    Ele pode concluir que na origem de informação codificada está sempre uma imteligência.

    A informação e o código não existe sem inteligência.

    É por isso que o Pedro Ferreira consegue aumentar a informação codificada numa página em branco.

    Quando escreve, o Pedro Ferreira mostra duas coisas:

    1) como se aumenta a informação numa página em branco;

    2) que a informação codificada só é possíve com uma origem inteligente.

    Daí que ele possa compreender que o DNA só pode ter tido origem inteligente.

    Porque contendo o DNA informação codificada, ele só pode ter tido uma origem inteligente.

    ResponderEliminar
  70. Mário Miguel15/12/08, 17:05

    A pratica de sexo por pessoas do mesmo sexo, que também são heterossexuais, pode até dar vantagem a uma dada população, não havendo constrangimentos quanto a reprodução.

    Os Espartanos incluíam nas fileira do seu exercito, militares que se faziam acompanhar dos seus amantes, tendo no entanto as sua mulheres com as quais se reproduziam, a vantagem de os soldados se fazerem acompanhar em batalha como seu amante, resultava numa melhor defesa do companheiro, visto que se defende mais facilmente com maior afinco com quem se está envolvido afectivamente, e isso resultava positivamente para a integridade de todo o exercito, bem como para a população defendida, os quadros superiores sabiam disso e suportavam esse procedimento. E como é sabido, os espartanos são conhecidos como tendo sido os precursores do treino militar moderno, sendo conhecidos pela bravura e sucesso nas batalhas. É que nem à fraqueza esse comportamento fica associado, nesse caso concreto, eram só vantagens com zero prejuízos.

    E é devido a essas características que ainda hoje a palavra "Espartano" é tida como austero, sóbrio, rigoroso, como se pode consultar aqui, no Dicionário da Priberam On-Line.

    Curioso reparar que muitos padres e bispos (postos elevados na igreja) não fazem ouvidos a esse impedimento.

    E constato que aqui disseram que na Bíblia/palavra de Deus não há contras à homossexualidade, pois bem, aqui vai:

    «Não haverá prostituta dentre as filhas de Israel; nem haverá sodomita dentre os filhos de Israel. Não trarás o salário da prostituta nem preço de um sodomita à casa do SENHOR teu Deus por qualquer voto; porque ambos são igualmente abominação ao SENHOR teu Deus.... Com homem não te deitarás, como se fosse mulher; abominação é... Quando também um homem se deitar com outro homem, como com mulher, ambos fizeram abominação. Dt 23.17; Lv 18:22; 20:13»

    Fica aqui um vídeo parcialmente off-topic.

    ResponderEliminar
  71. O João Vasco, se sabe escrever, sabe como é que se aumenta a informação codificada.

    Ele sabe, também, que é impossível aumentar a informação codificada sem uma inteligência e sem um código.

    Se sabe escrever, sabe isso.

    Então também pode compreender que:

    1) toda a informação codificada tem origem inteligente.

    2) o DNA tem informação codificada;

    3) o DNA só pode ter tido uma origem inteligente.

    Ele bem esperneia. Mas já está tostadinho.

    ResponderEliminar
  72. «O João Vasco, se sabe escrever, sabe como é que se aumenta a informação codificada. »

    Mas eu não disse que não sabia.

    Eu digo é que o Perspectiva não sabe. Por isso é irrelevante que fale sobre as origens de algo que não sabe o que é.

    E a prova é que continua sem responder à pergunta. Nas suas palavras, "Ele bem esperneia. Mas já está tostadinho.»

    ResponderEliminar
  73. O caos pode produzir padrões (v.g. cubos de gelo) mas não pode produzir informação codificada.

    Esta supõe sempre uma inteligência.

    As observações científicas mostram que:

    1) toda a informação codificada supõe sempre inteligência;

    2) o DNA tem informação codificada em quantidade, qualidade, complexidade e densidade que transcende toda a capacidade tecnológica humana;

    3) logo o DNA teve uma origem inteligente que transcende toda a inteligência humana.

    Como se vê, os evolucionistas bem esperneiam, mas já estão a grelhar.

    ResponderEliminar
  74. Mário Miguel15/12/08, 17:13

    Cuidado,

    Daqui a pouco começo a ter pena do Jónatas Machado - Perspectiva -, é que já se vê de Lisboa a coluna de fumo que sai da Faculdade de Coimbra, oriunda das meninges do Jónatas. Falta pouco para ele crachar com a cena da "Informação". LOL.

    Jánatas, esses ateus são umas melgas, não são?! O que que eles se lembraram de lhe fazer, os malvados.

    ResponderEliminar
  75. O João Vasco insiste na sua retirada estratégica:

    "Eu digo é que o Perspectiva não sabe. Por isso é irrelevante que fale sobre as origens de algo que não sabe o que é."

    É uma forma de espernear.

    Só que, quando escreve, ele enterra-se porque ao escrever ele corrobora a informação criacionista de que:

    1) que toda a informação codificada tem uma origem inteligente;

    2) ora, tendo o DNA informação codificada, segue-se que

    3) o DNA só pode ter tido uma origem inteligente.

    Continue a espernear, que não deixará de grelhar.

    ResponderEliminar
  76. Por isso, seria curioso que o perspetiva e todos os criacionistas se interrogassem a respeito do porquê da dificuldade de responder a estar pergunta tão simples. Nem sequer a este desafio são capazes de responder.

    Vão fazendo desaios, e os "evolucionistas" (como nos chamam) respondem a todos. Mas quando vos fazem um tão simples, desviam-se e mostram-se incapazes. Porque será?
    Às tantas é porque não têm razão absolutamente nenhuma. Parece a possibilidade mais plausível.

    ResponderEliminar
  77. O Mário Miguel já está a espernear e a grelhar.

    ResponderEliminar
  78. Perspectiva,
    Compare as dezenas de vezes que já lhe responderam a esse desafio (de tantas maneiras diferentes) com a NENHUMA que foi capaz de responder ao nosso.
    Em vez de responder já, pense sobre isso. Não sobre a resposta, que já sei que não é capaz de dar. Mas sobre aquilo que o leva a falar sobre o que não sabe....

    ResponderEliminar
  79. A forquilha criacionista diz:

    1) toda a informação codificada tem origem inteligente;

    2) o DNA tem informação codificada,

    3) Logo, o DNA teve uma origem inteligente.

    Em desespero de causa, o Ludwig Krippahl lembrou-se de afirmar que o DNA não codifica nada (a cebola seria talvez a única excepção).

    Mas vai grelhar na forquilha.

    A verdade é que Ludwig está, mais uma vez, errado.

    E o seu erro resulta de uma estratégia de fuga ao óbvio:

    A informação, enquanto grandeza imaterial, só pode ter uma origem inteligente e imaterial, pelo que a quantidade e a qualidade inabarcável de informação contida no DNA é inteiramente consistente com a fé num Deus imaterial, omnipotente e omnisciente.

    Para fugir a esta realidade, Ludwig Krippahl faz todas as acrobacias argumentativas possíveis e imaginárias, sem no entanto ir a lado nenhum.

    Ele é refutado pelos próprios evolucionistas.

    Richard Dawkins, no seu livro The Blind Watchmaker, 1986, p. 115, afirma que numa simples célula existe capacidade de armazenamento de informação correspondente a 3 ou quatro vezes os 30 volumes da Enciclopédia Britânica.

    É claro que Dawkins esquece (ou ignora deliberadamente) que a informação constante da Enciclopédia Britânica não se escreve a ela própria, nem surge através da combinação das moléculas da tinta e do papel.

    Essa informação, e o código em que é transmitida, tem sempre e só uma origem inteligente. E toda essa informação contida na Enciclopédia Britânica não nos consegue explicar como se faz uma simples célula.

    Lembremos que Richard Dawkins também está numa estratégia de fuga e negação. Ele também ainda não conseguiu explicação para a origem da informação.

    A verdade é esta: Deus programou as instruções para as estruturas e funções altamente complexas de todos os seres vivos na dupla hélice do DNA.

    Estas instruções, para além do conteúdo informativo que têm de acordo com a teoria matemática de Claude Shannon, obedecem a um código preciso e têm uma qualidade representativa de um conhecimento que escapa a toda a comunidade científica.

    Graças a esse código, os seres vivos reproduzem-se de acordo com a sua espécie, corroborando o que a Bíblia ensina no livro do Génesis.

    Contrariamente ao que Ludwig afirma (erradamente!), a informação codificada no DNA não é o resultado do funcionamento normal das leis da física ou química, mas implica um maquinismo extremamente complexo de descodificação no ribossoma.
    Sem a informação e sem a sua tradução a vida é impossível.

    Supreendentemente, esta complexa maquinaria de tradução e descodificação da informação está, em si mesma, codificado no DNA.


    Isto mesmo foi logo pertinentemente observado por Karl Popper: “o código não pode ser traduzido a não ser usando o produto da sua própria tradução”


    O próprio Karl Popper achou este facto um tremendo desafio para qualquer teoria da génese do código genético. As coisas não mudaram substancialmente desde então.


    O DNA é de longo o sistema de armazenamento de informação mais compacto do Universo.

    Mesmo o organismo vivo mais simples têm 482 genes codificadores de proteínas, num total de 580 000 letras. Os seres humanos têm cerca de 3 biliões de letras em cada núcleo celular.


    A quantidade de informação armazenada num volume de DNA do tamanho da cabeça de um alfinete equivale a uma pilha de livros da Terra até à Lua multiplicada por 500, cada um deles com um conteúdo diferente e altamente específico.


    Dito de outra maneira, enquanto que nós ficamos todos contentes com discos duros de 40 gigabites de informação, um volume de DNA do tamanho da cabeça de um alfinete armazena 100 milhões de vezes mais do que essa informação.


    Mas o DNA tem outras características interessantes.


    Uma delas é que as letras do DNA (ACGT) têm outra propriedade vital, devida à sua estrutura, que permite a transmissão de informação.


    A letra A faz par apenas com o T e o C apenas com o G, devido às propriedades químicas das bases.
    Isto significa que as duas linhas da dupla hélice podem ser separadas e que novas linhas podem ser formadas, copiando exactamente a informação.


    A nova linha contém a mesma informação que a anterior, embora não como fotocópia, mas como uma espécie de negativo.


    A cópia é extremamente precisa, já que existe cerca de 1 erro em 10 biliões de operações de cópia, graças ao mecanismo de edição e correcção automática, também ele codificado no DNA.


    Curiosamente, a tendência, como têm demonstrado o Projecto ENCODE (novamente a palavra código!) não é para negar a existência de um código no DNA, mas sim para afirmar a existência de vários códigos epigenéticos (para além dos genes) no DNA, na parte até há pouco considerada “junk”.


    Ou seja, hoje reconhece-se a existência de não apenas um mais muitos códigos dentro do DNA. A complexidade do DNA só tende a aumentar, o que aumenta o espaço para os criacionistas (crentes num Deus omnisciente e omnipotente) e diminui a margem de manobra dos evolucionistas (crentes no acaso).


    E o Ludwig diz que o DNA não codifica nada!!!


    Estimado Ludwig: será que quer que sobrecarregue o seu blogue com referências à informação codificada no DNA?

    Vai grelhar na forquilha evolucionista (em tom de bricadeira, claro).

    ResponderEliminar
  80. Caro Jónatas,

    «é impossível refutar que:
    a) toda a informação codificada tem origem inteligente
    b) o DNA tem informação codificada.
    c) Logo, o DNA tem origem inteligente.»


    É impossível refutar porque o Jónatas não explica o que quer dizer com "informação codificada".

    Também não pode refutar que

    a) todos os mafaguinhos são calafráticos
    b) todos os zebedoings são mafaguinhos
    c) logo, todos os zebedoings são calafráticos

    Mas a impossibilidade de refutar um disparate sem sentido não faz dele uma verdade.

    Por isso ou define com algum rigor o que entende por "informação codificada" ou a irrefutabilidade da sua afirmação deve-se apenas à sua falta de sentido.

    ResponderEliminar
  81. Perspectiva,

    "Compare as dezenas de vezes que já lhe responderam a esse desafio (de tantas maneiras diferentes) com a NENHUMA que foi capaz de responder ao nosso."

    Para o João Vasco aumentar a informação codificada no Ktreta é necessário:

    1) uma inteligência (a do João Vasco)

    2) informação (as ideias do João Vasco)

    3) um código (a língua portuguesa usada pelo João Vasco)

    4) uma operação de codificação (a escrita)

    Nada disso seria possível sem inteligência.

    O aumento aleatório de símbolos (v.g. siopjgºsojkbºloskn~p+skno+qmjºkoqhg+0qumºqlkhjwok) aumentaria o ruído, não a informação.

    Daí que continue a ser verdade que:

    1) a informação codificada e o respectivo aumento têm uma origem inteligente; (nunca ninguém demonstrou o contrário)

    2) o DNA tem informação codificada; (nunca ninguém demonstrou o contrário)

    3) o DNA só pode ter tido uma origem inteligente; (dizer o contrário não tem qualquer fundamento)

    e o João continua a grelhar.

    Como se vê, um criacionista pode afirmar claramente a sua fé criacionista, sem qualquer receio de ser refutado.

    ResponderEliminar
  82. Perspectiva,

    cá vai uma definição que lhe poderá interessar:

    ridículo


    do Lat. ridiculu, que provoca o riso


    adj.,
    que provoca ou desperta o riso ou o escárnio;
    irrisório;
    de pouco valor;
    insignificante;

    s. m.,
    pessoa ou coisa ridícula.
    meter a -: expor à troça;
    prestar-se ao -: dar motivo a ser escarnecido.

    ResponderEliminar
  83. Caro Jónatas,

    Leia isto:

    «o DNA tem informação codificada»

    Percebe o significado? Entende o que está escrito? Pois bem, isso é sinal de um código inteligente.

    Agora leia isto:

    TACCACGACAGAGGACGGCTGTTCTGGTTGCAGTTCCGGCGGACCCCGTTCCAACCGCGCGTGCGACCGCTCATACCACGCCTCCGGGACCTCTCCTACAAGGACAGGAAGGGGTGGTGGTTCTGGATGAAGGGCGTGAAGCTGGACTCGGTGCCGAGACGGGTCCAATTCCCGGT

    Se sabe a que cada letra corresponde então sabe o código que os bioquímicos inventaram para designar cada nucleótido na sequência.

    Mas que raio propõe seja o significado dessa sequência? A molécula tem um efeito na célula, mas efeito não é significado. Quem acha que lê e dá significado a isto? O ribossoma é inteligente?

    Já agora, veja Miscelânea criacionista: outra vez a treta do código...

    ResponderEliminar
  84. Ludig diz:

    "É impossível refutar porque o Jónatas não explica o que quer dizer com "informação codificada".

    Se sabe escrever, o Ludwig sabe o que é informação codificada.

    É informação cuja transmissão e armazenamento se realiza através de um conjunto de símbolos que representam ideias, conceitos, operações, instruções, etc.

    A forquilha criacionista baseia-se em observações científicas. É por isso que não pode ser refutada.

    As mesma não é um disparate, na medida em que pode ser confirmada todos os dias.

    1) Sempre que existe informação codificada através de uma linguagem em computadores, telemóveis, aviões, naves espaciais, ATMs, livros, etc, existe uma origem inteligente.

    Isso pode ser observado todos os dias.

    2) No DNA existe informação codificada. Isso é amplamente corroborado por todos quantos estudam o DNA.

    3) Logo, o DNA só pode ter tido origem inteligente. Isso é assim porque resulta de duas premissas amplamente corroboradas.

    Não é um disparate. É mesmo assim. Baseia-se no que pode ser observado e corroborado, todos os dias, por todas as pessoas.

    A forquilha criacionista espetou o Ludwig e vai faê-lo grelhar.

    ResponderEliminar
  85. Perspectiva diz:

    Continua a ter toda a validade a forquilha criacionista, que grelha o evolucionismo:
    1) toda a informação codificada tem sempre na origem uma inteligência;
    2) o DNA tem informação codificada;
    3) Logo, o DNA teve uma origem inteligente
    ”.

    Parece interessante “a forquilha” criacionista. Mas apenas parece. Como todas as outras suas “forquilhas”, esta também não passa de forquilha falaciosa. Nada vale como argumento.

    Para o argumento ser sólido falta tornar as premissas plausíveis, falta justificá-las. Como justifica que “toda a informação codificada tem sempre na origem uma inteligência”? Como justifica que “o DNA tem informação codificada”? Porquê que o DNA apenas teve origem inteligente? Se a teve, já não a terá? De facto a constante criação do DNA nas combinações que o tornam viável não evidencia qualquer origem inteligente, mas relações necessárias.

    Mais. Qualquer coisa não contém informação, sobre si ou sobre o que for. Qualquer coisa é (assim ou assado, desta ou daquela forma). Nós é que criamos informação sobre qualquer coisa, por transformação do nosso conhecimento sobre ela (que mais não é do que a sua reconstituição conceptual), num produto informativo (a divulgação do nosso conhecimento aos outros). Nós é que podemos atribuir significado às relações que ocorrem numa coisa ou entre coisas, inclusivamente podemos atribuir o significado de código de expressão, de causa e efeito, a essas relações (nomeadamente porque uma mesma combinação ou relação se exprime da mesma forma). As relações existentes nas coisas ou entre elas existem porque só assim, e não de outra forma, as coisas podem existir. E existem assim, e não assado, devido a miríades de mútuos constrangimentos.

    Onde reside a inteligência na produção do que é produzido por constrangimento? Ou a inteligência é “o que tem de ser tem muita força”? Julgo que a inteligência é algo diferente de força.

    ResponderEliminar
  86. «O aumento aleatório de símbolos (v.g. siopjgºsojkbºloskn~p+skno+qmjºkoqhg+0qumºqlkhjwok) aumentaria o ruído, não a informação. »


    E o aumento aleatório de símbolos também não pode Galavrar.
    Logo, o criacionismo está errado.

    E agora, como refuta esta?
    Lá está o perspectiva a grelhar...

    ResponderEliminar
  87. E já que fala em aumentos de informação, como os define, objectivamente?

    ResponderEliminar
  88. Ludwig diz:

    "Se sabe a que cada letra corresponde então sabe o código que os bioquímicos inventaram para designar cada nucleótido na sequência."

    O código genético não foi inventado pelos bioquímicos!!

    O código foi descoberto pelos bioquímicos!!

    Eles limitaram-se, depois, a fazer corresponder aos nucleótidos determinadas letras, assim como fazem corresponder a palavra "pedra" a uma pedra.

    Significa isso que uma pedra tem informação codificada?

    Claro que não!

    Mas não é o código "inventado pelos bioquímicos" que codifica toda a informação necessária para o fabrico do ser humano.

    Pelo simples facto de que os bioquímicos não têm essa informação.

    Mas essa informação existe no núcleo da célula, e é transcrita, traduzida, e copiada para

    Este processo de tradução e execução de informação codificada não foi criado pelos bioquímicos.

    Os bioquímicos é que foram criados por este processo.

    Não são os bioquímicos que criam o código genético.

    É o código genético que, depois de transcrito, traduzido, copiado e executado, cria os bioquímicos.

    Mas o código está na capacidade que os nucleótidos têm para representar aminoácidos e proteínas e para regularem com precisão a fabricação de organismos, máquinas moléculares e seres vivos extremamente complexos.

    O código existe no interior do núcleo da células dos bioquímicos e garante a sua reprodução.

    Está enganado, Ludwig.

    A forquilha criacionista funciona:

    1) toda a informação codificada tem uma origem inteligente:

    2) o DNA tem informação codificada(capaz de criar bioquímicos)

    3) Logo, o DNA teve uma origem inteligente.

    O Ludwig, se continuar assim, vai mesmo grelhar.

    ResponderEliminar
  89. Jónatas,

    «Eles limitaram-se, depois, a fazer corresponder aos nucleótidos determinadas letras, assim como fazem corresponder a palavra "pedra" a uma pedra.»

    Exacto. Mesmo contra vontade parece que já percebeu :)

    A palavra "pedra" tem informação codificada porque é um sinal que se convenciona designar a pedra. A pedra não tem informação codificada nenhuma porque é uma pedra independentemente das convenções que arranjemos.

    As letras ATCG têm informação codificada no contexto da genética molecular porque se convencionou designarem elementos da sequencia dos genes. Mas o ADN em si não tem informação codificada porque não está dependente de nenhuma convenção para lhe dar significado.

    Veja Miscelânea criacionista: outra vez a treta do código...

    ResponderEliminar
  90. E já agora,

    Eu tenho um poema, será que uma letra acrescentada ao acaso pode melhorar a sua qualidade?

    Intuitivamente, parece difícil, mas possível. No entanto, visto que a qualidade de um poema não pode ser medida objectivamente, é ridículo afirmar que isso é impossível, visto que não pode existir nenhuma medição de qualidade factual. A qualidade pode ter aumentado ou diminuido, consoante o gosto de cada um.

    Este é o problema de se falar em "aumento de informação" do ADN. Ou bem que se fala no número de bits, ou bem que falamos em qualidade da informação, mas aí não existe nenhum critério objetivo para a definir. Porque qualquer que fosse o critério a partir do momento em que seria possível fazer uma transformação que aumentasse a informação, essa transformação estaria acessível ao ruído, visto que este é por definição aleatório. Seria apenas uma questão de probabilidades.

    Por isso, se o Perspectiva soubesse do que fala, reconheceria logo as asneiras que afirma. É por isso que os cientistas rejeitam o criacionismo, mesmo os crentes. Por isso é que não existe um cientista Português qe seja capaz de secundar publicamente as afirmações do "Perpectiva" - porque quem sabe de ciência raidamente chega à conclusão de que são disparatadas.

    ResponderEliminar
  91. CL pergunta:

    "Como justifica que “toda a informação codificada tem sempre na origem uma inteligência”?

    Isso sempre acontece. Não existe qualquer observação em sentido contrário.

    "Como justifica que “o DNA tem informação codificada”? "

    Toda a gente reconhece isso, incluindo Crick, Watson, Sagan, Dawkins, etc.

    "Porquê que o DNA apenas teve origem inteligente?"

    Porque a informação codificada tem sempre uma origem inteligente.


    "Se a teve, já não a terá? De facto a constante criação do DNA nas combinações que o tornam viável não evidencia qualquer origem inteligente, mas relações necessárias."

    A constante "criação" de DNA é regulada pela informação codificada no DNA, e esta só pode ter tido uma origem inteligente.

    ResponderEliminar
  92. Perspectiva:

    Qual é a definição objectiva para "aumento de informação"?

    ResponderEliminar
  93. Ludwig diz:

    "A palavra "pedra" tem informação codificada porque é um sinal que se convenciona designar a pedra."

    A informação não está na pedra, mas na linguagem utilizada para a designar. Ela é o produto de inteligência.

    "A pedra não tem informação codificada nenhuma porque é uma pedra independentemente das convenções que arranjemos."

    Um criacionista não diria melhor.

    "As letras ATCG têm informação codificada no contexto da genética molecular porque se convencionou designarem elementos da sequencia dos genes."

    Claro. Mas aí estamos a falar do facto de que designamos a adenina, a timina a citosina e a guanina através das letras ATCG. Mas isso não é o código genético.

    Isso é a nossa linguagem a codificar essa informação. Um chinês poderia usar outros símbolos.

    "Mas o ADN em si não tem informação codificada porque não está dependente de nenhuma convenção para lhe dar significado"

    Claro que tem. Aí é que o Ludwig se engana.

    A informação está contida nas sequências de nucleótidos, as quais, independentemente dos símbolos que usemos para as designar, contêm toda a informação necessária para especificar todos os seres vivos e garantir a sua produção, sobrevivência e reprodução.

    Isso já acontecia muito antes de os bioquímicos decidirem chamar ATCG aos nucleótidos.

    Na verdade, como disse, os bioquímicos existem porque a informção para a sua produção estava codificada no DNA.

    ResponderEliminar
  94. Como se vê, a forquilha criacionista continua de pé.

    Os criacionistas não se enganaram.

    1) toda a informação codificada tem origem inteligente

    2) o DNA tem informação codificada

    3) o DNA só pode ter tido origem inteligente

    Sobre a premissa 2) lemos em Richard Dawkins, The Blind Watchmaker:

    "Every single one of more than a trillion cells in the body contains about a thousand times as much precisely-coded digital information as my entire computer."

    É isso mesmo que os criacionistas têm em mente quando dizem que o DNA tem informação codificada.

    Essa informação codificada não está nas letras ATCG. Está nas sequências de nucleótidos no núcleo da célula.

    Ela não está armazenada nos livros de biologia molecular. Ela está dentro da célula.

    O Ludwig, deliberada ou insconscientemente, está errado.

    E por isso, arrisca-se mesmo a grelhar na forquilha.

    ResponderEliminar
  95. Jónatas,

    «Como se vê, a forquilha criacionista continua de pé.[...]
    O Ludwig, deliberada ou insconscientemente, está errado.
    E por isso, arrisca-se mesmo a grelhar na forquilha.»


    Desculpe lá, mas se vai fazer churrascos com a forquilha de pé a única coisa que vai grelhar é a mão...

    ResponderEliminar
  96. A forquilha criacionista grelha mesmo.

    1) Toda a informação codificada tem uma origem inteligente;

    2) o DNA tem informação codificada;

    3) o DNA só pode ter tido uma origem inteligente.

    O Ludwig Krippahl (LK) diz que os buioquímicos é que inventaram o código genético ao darem os nomes aos nucleótidos.

    Mas o código genético refere a informação sobre a produção e reprodução de seres vivos contida no núcleo da célula, muito antes de os bioquímicos a descobrirem.

    Na verdade, os bioquímicos são o produto da informação contida no núcleo da célula.

    É essa a informação codificada de que estamos a falar.

    Sobre ela, Dawkins diz (The Blind Watchmaker)

    "Each nucleus, as we shall see in Chapter 5, contains a digitally coded database larger, in information content, than all 30 volumes of the Encyclopaedia Britannica put together.

    And this figure is for each cell, not all the cells of a body put together."

    Isso era assim, muito antes de alguém se lembrar de estudar bioquímica.

    ResponderEliminar
  97. Ludwig diz:

    "Desculpe lá, mas se vai fazer churrascos com a forquilha de pé a única coisa que vai grelhar é a mão..."

    Já está a espernear e a grelhar. Mas não vai fazer mais do que isso.

    ResponderEliminar
  98. A forquilha criacionista vai grelhar os evolucionistas.

    Eles vão, naturalmente, espernear, visto nada poderem fazer contra ela.


    1. Todas as línguas, códigos, protocolos ou mecanismos de codificação, descodificação, crifração, decifração, etc., têm origem inteligente. Não existem excepções conhecidas.

    2. O DNA é uma linguagem, um código, uma cifra, um protocolo e um mecanismo de codificação e descodificação.

    3. Por isso, o DNA teve uma origem inteligente.


    Esta forquilha tem grandes implicações para a avaliação do Big Bang, da origem da vida, do hipotético ancestral comum, das mutações, selecção natural, especiação, registo fóssil, etc.

    ResponderEliminar
  99. Perspectiva,
    Para entender melhor os seus argumentos, peço que me diga,por favor, qualé a sua definição objectiva para aumento de informação?
    E não estou nada zangada por colocar esta pergunta pela enésima vez sem obter resposta alguma. Caso o seu criador alguma vez achar que a soberba é razão para a forquilha e grelha, fale comigo que eu prometo meter uma cunha para si, nem que seja pelo divertimento que me proporciona na qualidade de «comic relief».
    Obrigada
    Cristy

    ResponderEliminar
  100. Perspectiva,

    penso que após esta verborreia incrivel de sua parte (embora, por mais simbolos que tenha adicionado, a informação objectiva, coitadinha, não aumentou um milésimo), creio que o que está a grelhar não são os defensores da teoria da evolução, mas sim o seu cérebro.
    E pelo aspecto dos posts, já está para além do estado bem-passado. Penso que pouco mais resta que carvão e umas células que lhe permitem ir fazendo um frenético copy-paste de um monte de afirmações que oscilam entre o falacioso, o ridículo e o autista.

    Passe bem e as melhoras,
    Rui

    ResponderEliminar
  101. O problema da argumentação criacionista acerca da inteligencia é que pressupoem que inteligencia implica intenção e tal não é um facto. Mesmo que se aceite que a informação do DNA é uma forma de inteligencia a que podemos metaforicamente chamar codigo, ela não implica ter sido criada intencionalemente. De facto a inteligencia criada por meios artificiais satisfaz a condição de criar informação de forma inteligente e auto-evoluida mas não satisfaz a condição da intencionalidade. Ou seja, a natureza é capaz de criar organismos inteligentes e mecanismos inteligentes (desde os mais simples como uma solução tampão) mas isso não implica que tenha havido intencionalidade na sua origem. Quanto ao caracter inteligente, esse é por conseguinte, uma interpretação humana, sendo que inteligencia é um conceito, uma teoria. Porque?
    O cerebro humano, para facilitar a sua compreensão do mundo procura catalogar experiencias e identificar padrões. Por isso ha quem veja faces humanas em Marte, cabeças de velha nos granitos da Serra da Estrela e cavalos alados nas formas das nuvens. Não é um defeito cognitivo, é uma adaptação para processar o ambiente mais depressa, senão demorava uma eternidade para concluir por exemplo que um cão era um cão.
    O que os criacionistas querem fazer é criar uma duvida baseada nesta tendencia para o catalogo e padronização que o cerebro humano tem. A ciencia mostrou como podemos transcender este tipo de obstaculos, mas o criacionismo mantem uma teimosa alegação de que o que parece é. O mecanismo evolutivo parece inteligente, é demasiado complexo para ser entendido sem esforço, então vamos usar isso para fazer uma teoria.
    Mas ver inteligencia consciente na evolução é igual a ver banda desenhada nos nós de uma pedra de marmore. Ou a cara do Kenedy no Grand Canion.

    A evolução é um mecanismo que se quiserem chamar inteligente, esta muito bem por mim, mas que ele é ocasional é. Ha um acumular de acontecimentos ocasionais, selecionados por um mecanismo muito simples de persistencia (os que são prejudiciais à continuidade - não continuam...) e que no muito longo prazo podem dar alterações vantajosas. e no maior longo prazo ainda alteraçoes desvantajosas.

    So por nota de rodape- foram descobertos mais uns genes (ja se conheciam para ai uns 10) que actuam na especiação ao tornarem inferteis a descendencia de animais demasiado diferentes. Ver Nature news hoje.

    ResponderEliminar
  102. "De facto a inteligencia criada por meios artificiais satisfaz a condição de criar informação de forma inteligente e auto-evoluida mas não satisfaz a condição da intencionalidade"

    referia-me a inteligencia artificial e a informação criada por esta

    ResponderEliminar
  103. Cristy diz:

    "Para entender melhor os seus argumentos, peço que me diga,por favor, qual é a sua definição objectiva para aumento de informação?"

    Depende. Eu estou a falar de informação codificada, como aquela que se colhe das suas palavras.


    Como é que aumenta a informação num texto que escreve? A resposta que servir para si, serve, no essencial, para um computador, um telemóvel, ou DNA.

    Mas para aumentar a informação codificada é necessário começar por ter a informação não codificada na própria mente.

    Nesse sentido, um aumento de informação depende não apenas da quantidade de letras (que podem ser ruído), mas acima de tudo da quantidade e qualidade de conceitos, ideias, instruções, etc. que alguém consegue codificar num livro, programa informático, DNA, etc.

    Nesse sentido, um aumento de informação coldificada depende sempre de um código (que é sempre uma criação inteligente) e do aumento de símbolos e significados que esse código reconhece.

    Também depende do sistema de armazenamento de que se dispõe.

    Se eu tiver apenas uma folha em branco, não consigo armazenar tanta informação codificada como se tiver mil.

    É com base em ideias, linguagem, codificação, sistema de armazenamento,etc., que um programador aumenta a informação de um computador, de um telemóvel, de uma ATM, a fim de lhe permitir a realização de novas e mais complexas operações.

    O mesmo sucede relativamente ao DNA.

    "E não estou nada zangada por colocar esta pergunta pela enésima vez sem obter resposta alguma."

    Já demos a resposta váriaz vezes, mas nunca ninguém a criticou. Limitam-se a dizer que nunca demos uma resposta, o que é uma maneira de grelharem na forquilha criacionista.

    Entretanto vão tentando ganhar tempo para procurar respostas mais substanciais.

    "Caso o seu criador alguma vez achar que a soberba é razão para a forquilha e grelha, fale comigo que eu prometo meter uma cunha para si, nem que seja pelo divertimento que me proporciona na qualidade de «comic relief».

    Lamento não conseguir arranjar-lhe uma saída mais airosa que não a de grelhar na forquilha criacionista, segundo a qual:

    1) toda a informação codificada tem uma origem inteligente;

    2) o DNA tem informação codificada;

    3) o DNA teve uma origem inteligente.

    Obrigada
    Cristy

    De nada.

    ResponderEliminar
  104. O Rui também já está a grelhar.

    Não consegue refutar os argumentos da forquilha criacionista.

    ResponderEliminar
  105. O Rui também já está a grelhar.

    Não consegue refutar os argumentos da forquilha criacionista.

    ResponderEliminar
  106. Perpectiva:

    Só ha inteligencia nos genes porque a vê lá. Por um lado.

    Por outro lado, como ilustrado pela inteligencia artificial, inteligencia e intencionalidade são coisas diferentes. O mecanismo pode ser inteligente mas não de origem intecional ou consciente. Ou acha que os computadores têm intenção? Ou que o proprio genoma tem intenções, ja que admite que é inteligente?

    Não me está a propor que Deus não tem intenção pois não?

    ResponderEliminar
  107. João diz:


    "Ou seja, a natureza é capaz de criar organismos inteligentes e mecanismos inteligentes (desde os mais simples como uma solução tampão) mas isso não implica que tenha havido intencionalidade na sua origem."

    O problema é que toda a informação codificada tem sempre origem inteligente, não se conhecendo excepções.

    Os seres vivos dependendem de informação codificada, pelo que isso corrobora a doutrina Bíblica de que eles têm origem inteligente.

    "Quanto ao caracter inteligente, esse é por conseguinte, uma interpretação humana, sendo que inteligencia é um conceito, uma teoria. Porque?"

    É a interpretação mais consistente com as observações cientificas. Estas mostram que não existe informação codificada sem inteligência e que o DNA tem informação codificada.

    Daí que ela só possa ter tido uma origem inteligente.

    Afirmar o contrário é pura especulação sem sentido.


    "O cerebro humano, para facilitar a sua compreensão do mundo procura catalogar experiencias e identificar padrões."

    O cérebro humano é produto de informação codificada, pelo que só pode ter tido uma origem inteligente.

    De resto, os evolucionistas reconhecem que não fazem a mais pequena ideia de como ele possa ter evoluído.

    "Por isso ha quem veja faces humanas em Marte, cabeças de velha nos granitos da Serra da Estrela e cavalos alados nas formas das nuvens."

    Mas nada disso é informação codificada, capaz de ser transcrita, traduzida e executada em ordem à produção de organismos extremamente complexos, integrados e funcionais.

    "Não é um defeito cognitivo, é uma adaptação para processar o ambiente mais depressa, senão demorava uma eternidade para concluir por exemplo que um cão era um cão."

    Sim. Mas uma coisa é ver uma nuvem com forma de cavalo, uma outra é ter quantidades inabarcáveis de informação codificada em sequências de nucleótidos capaz de produzir e reproduzir os seres vivos mais complexos que se conhece.

    De resto, pelo seu argumento, se um arqueólogo descobrisse uma pedra com hieroglifos teria que concluir que não existe aí informação codificada, mas tudo é apenas impressão do arqueólogo.


    "O que os criacionistas querem fazer é criar uma duvida baseada nesta tendencia para o catalogo e padronização que o cerebro humano tem."

    Que disparate.

    Aplique isso a um arqueólogo que descobre múltiplos sinais numa pedra de uma pirâmide e diga-lhe que isso é apenas uma tendência do cérebro para o catálogo e padronização.

    "A ciencia mostrou como podemos transcender este tipo de obstaculos, mas o criacionismo mantem uma teimosa alegação de que o que parece é."

    A ciência mostra que sempre que temos informação codificada, temos uma inteligencia. No DNA temos informação codificada, logo temos inteligência.


    "O mecanismo evolutivo parece inteligente, é demasiado complexo para ser entendido sem esforço, então vamos usar isso para fazer uma teoria."

    O mecanismo evolutivo não existe. É pura imaginação, se prova.

    A aparência de inteligência deve-se ao facto de a vida depender de informação codificada e de esta ter sempre uma origem inteligente.

    "Mas ver inteligencia consciente na evolução é igual a ver banda desenhada nos nós de uma pedra de marmore."

    A pedra é sempre uma pedra. Ela não transcreve, traduz ou executa um conjunto de instruções codificadas, diferentemente do que sucede com o DNA.

    "Ou a cara do Kenedy no Grand Canion."

    Isso aplica-se aos rostos dos quatro presidentes americanos no Monte Rushmore?

    "A evolução é um mecanismo que se quiserem chamar inteligente, esta muito bem por mim, mas que ele é ocasional é."

    A evolução é impossível. Não adianta partir do princípio de que aconteceu, porque a mesma é impossível.

    Não existe informação codificada sem origem inteligente, e o DNA tem informação codificada.

    "Ha um acumular de acontecimentos ocasionais, selecionados por um mecanismo muito simples de persistencia (os que são prejudiciais à continuidade - não continuam...) e que no muito longo prazo podem dar alterações vantajosas."

    Isso é pura imaginação, para a qual não existe nenhuma evidência. Para dizer isso basta crêr na evolução...

    O problema é que no DNA existe informação codificada e não se conhece informação codificada sem inteligência.

    "e no maior longo prazo ainda alteraçoes desvantajosas."

    Pura conversa fiada.

    "So por nota de rodape- foram descobertos mais uns genes (ja se conheciam para ai uns 10) que actuam na especiação ao tornarem inferteis a descendencia de animais demasiado diferentes. Ver Nature news hoje."

    A especiação diminui a quantidade e a qualidade da informação genética disponível.

    A população nova tem menos informação do que aquela de que descende.

    A especiação acontece. A evolução de partículas para pessoas, não.

    A verdade é esta.

    O João não mostrou como é que a informação codificada pode surgir sem inteligência,nem mostrou que no DNA não existe informação.

    Daí que também ele esteja condenado a grelhar espetado na forquilha criacionista.

    ResponderEliminar
  108. E sim, caso tenha ficado intrigado com a minha alegação da inteligencia artificial, ela é capaz de criar informação inteligente. Sendo ela propria fruto de uma inteligencia consciente não se pode dizer o mesmo da informação por ela gerada.

    ResponderEliminar
  109. Mas se quiser compreender mais, leia o meu comentario das 18:50

    ResponderEliminar
  110. João Vasco pergunta:

    "Ou acha que os computadores têm intenção? Ou que o proprio genoma tem intenções, ja que admite que é inteligente?"

    O nível da sua pergunta é baixo, mas está bem.

    Por detrás de informação codificada num computador ou num genoma existe sempre uma inteligência.

    Não existe informação codificada sem inteligência.

    Um avião, um carro, um telemível, uma ATM, etc., não são em si mesmos são inteligentes, mas não se conseguem explicar sem uma inteligência.

    Um computador pode realizar operações típicas da inteligência (v.g. cálculo) se for inteligentemente programado para o efeito.


    O mesmo vale para o DNA. Ele tem informação codificada, logo só pode ter uma origem inteligente, porque não existe outra fonte de informação codificada que não uma inteligência.

    Vão pensando nisto.

    ResponderEliminar
  111. Joãoi diz:

    "caso tenha ficado intrigado com a minha alegação da inteligencia artificial, ela é capaz de criar informação inteligente. Sendo ela propria fruto de uma inteligencia consciente não se pode dizer o mesmo da informação por ela gerada."

    A resposta está em...

    "Sendo ela propria fruto de uma inteligencia consciente"


    Voilá.

    A informação codificada supõe sempre um código, e este uma inteligência.

    ResponderEliminar
  112. Todos os seres humanos tem uma quantidade enciclopédica de informação, que é o “livro de receitas“ para a produção de todas as suas maquinaria e estruturas extremamente complexas.

    Essa informação é armazenada e transmitida para a geração seguinte na forma de uma mensagem em “letras” de DNA.

    Mas a mensagem está armazenada na sequência das letras, não nas letras em si mesmas.

    A mensagem necessita de um equipamento de descodificação e transmissão, para cujo fabrico as instruções estão armazenadas na própria mensagem.

    A escolha do código e até mesmo as letras são soluções optimizadas.

    O código genético é um sistema irredutivelmente complexo, sendo que a correspondência entre as sequências de letras e o seu significado (v.g. em aminoácidos) só pode ter sido o resultado de uma decisão intelectual voluntária.


    Tudo isto corrobora a crença num Deus que criou o mundo de acordo com a sua vontade expressa na sua Palavra.


    A forquilha criacionista funciona bem, como se viu.

    Ninguém refutou cientificamente as suas premissas, nem ninguém pode negar a sua conclusão.

    Mas se alguém quiser continuar grelhar, vamos a isso.

    Temos tempo.

    ResponderEliminar
  113. Perspectiva:

    Não preciso de lhe responder ponto por ponto ainda que tal seja facil.

    Toda a sua argumentação é baseada em premissas. Injecçoes de postulados. Que não são muito mais elaboradas que "os criacionistas é que sabem e a verdade é:...".

    Se me responder com mais inteligencia respondo-lhe mais concretamente, até lá fico à espera.

    Menos assertações e mais argumentos por favor.

    ResponderEliminar
  114. Perspectiva diz:

    1-“"Como justifica que “toda a informação codificada tem sempre na origem uma inteligência”? Isso sempre acontece. Não existe qualquer observação em sentido contrário”.

    Justificação: isso sempre acontece! A simples afirmação como justificação. Outra justificação: não existe observação em contrário! Logo, é desnecessário justificar com observações as afirmações que não sejam refutadas por observações. Afirmações podem ser refutadas com outras afirmações; são desnecessárias observações. Mas, além do mais, existem observações refutantes daquela afirmação (que mostram combinações possíveis dos constituintes do DNA, e não outras, que não constituem informação, mas combinações possíveis estáveis), ao passo que não existem observações confirmantes.

    2-“"Como justifica que “o DNA tem informação codificada”? ". Toda a gente reconhece isso, incluindo Crick, Watson, Sagan, Dawkins, etc.”.

    O uso do argumento de autoridade (de onde também se comprova a má qualidade dos argumentos de autoridade). Também antes de Galileu, eventualmente toda a gente dizia que o Sol girava à volta da Terra. E, aqui, o nosso amigo Perspectiva, como as autoridades que invoca, comete o erro de tomar a quantidade de informação que nós podemos ter, através do conhecimento que vamos obtendo das inúmeras relações que fazem o DNA ser o que é e exprimir-se das formas por que se exprime, com informação que o DNA contenha. Não há meio dele compreender que a informação também é um produto humano. O raio do seu DNA, como o de todos nós e dos restantes seres, parece ter uma origem pouco inteligente; daí que produza seres de inteligência tão variada.

    Os átomos, e as partículas elementares que os constituem, igualmente de criação inteligente e constituintes do DNA, também devem ter carradas de informação codificada. Assim como a mais elementar e efémera das partículas elementares, ou da energia de que serão constituídas. Para mal dos nossos pecados, ainda não conseguimos ter acesso a tão recôndita e avassaladora informação. E a suprema inteligência criadora, teima em não nos dar uma ajuda.

    3-“"Porquê que o DNA apenas teve origem inteligente?". Porque a informação codificada tem sempre uma origem inteligente.

    Aqui, o nosso amigo, não compreendeu o desfasamento no tempo do verbo usado na proposição de conclusão do seu argumento, e contenta-se com o raciocínio circular. Mas, se até os diamantes, que demoram uma “eternidade” a serem formados, já têm os seus homólogos de criação inteligente (a nossa), que apesar das dificuldade e das imperfeições os produz muito mais rapidamente, chegará o tempo em que também teremos DNA com origem inteligente. Então, poderemos, com propriedade, afirmar que esse tem origem inteligente.

    A conversa que por aqui vai é um excelente aperitivo para o jantar. Só é pena que a de Perspectiva seja hilariante. Poderia ser estimulante se fosse um pouco mais inteligente.

    ResponderEliminar
  115. O João vasco não perguntou nada disso. Isso foi outro João.

    O João Vasco apenas pergunta porque é que - agora que ficou aqui provado que o perspectiva não sabe do que fala - ele continua em insistir em fazer afirmações que não compreende.

    ResponderEliminar
  116. Perspectiva,

    eu também sei jogar o joguinho do mete-nojo, quer ver?

    "O Perspectiva não consegue responder com o mínimo de lógica nem pensamento encadeado às questões de pessoas com formação e experiencia em ciência. Portanto, na retrete evolucionista, já começa a cheirar muito mal"

    ResponderEliminar
  117. Jónatas, admiro a tua paciência.

    Sugiro arranjes uma câmera de filmar, filmes-te a ti próprio, ponhas o video na Youtube, e depois sempre que um darwinista duvidar do facto científico do ADN ser um código de informação, referencias o tal video.

    Não deveria ser surpresa que os darwinistas rejeitem os dados científicos quando estes apontem para o Criador. Deus fala sobre isso em Romanos 1. Ele Mesmo mostra a irracionalidade por trás do ateísmo no Salmo 14:1.

    Enfim....

    ResponderEliminar
  118. Pedro Ferreira15/12/08, 21:31

    Mats,

    "Jónatas, admiro a tua paciência."

    Paciência e casmorrice, podem ser facilmente confundidas mas são conceitos diferentes.

    ResponderEliminar
  119. Mats,

    Porque é que achas que o Perspectiva não é capaz de responder à pergunta "como é que se define, objectivamente, um aumento de informação"?

    E já agora, sabes tu responder a esta pergunta?

    ResponderEliminar
  120. Não tenho tido tempo para dar uma olhadela ao blog nos dias de semana por, e ao chegar a casa para ver um e-mail importante, aproveito para o fazer. Reparei que cerca de 75% do espaço é dedicado ao perspectiva. E não têm qualquer relação com o artigo, revelando quão fanático e cego, já que ele nunca responde a perguntais fundamentais às questões - como a questão da definição de um termo que usa -, mas acusa os outros de não responderem os seus comentários de imensas páginas.

    Deixo-lhe umas excerto de "As Grandes Ideias Que Moldaram o Nosso Mundo", de Pete Moore, sobre Claude Shannon:
    «Os computadores podem constituir para a humanidade um instrumento poderoso de tratamento e processamento de informação. No entanto, teriam sido inúteis se ninguém tivesse parado para compreender o significado de informação. A teoria da informação de Claude Shannon funciona separando o previsível do imprevisível, afirmando que apenas os dados imprevisíveis constituem informação. O seu próximo critério consistia em codificar essa informação em pequenas sequências com os números mais básicos disponíveis - 1s e 0s. Desta forma, a informação podia ser tratada por ordens de interruptores mecânicos e transmitidos através de linhas telegráficas. Ao fazer isso, Shannon tinha passado da informação à comunicação
    Essa é apenas a introdução completa. Coloco mais um excerto:
    «Lançar um dado que tem o número 6 em cada um dos seus lados não revelava qualquer informação, uma vez que o resultado é totalmente previsível. Tal concepção de informação revela, imediatamente, um modo de reduzir a quantidade de dados que precisamos que sejam acumulados ou transmitidos. Se o dado rolasse 100 vezes, não necessitaríamos de gravar 100 seis, apenas dizer 100x6.»

    Isso define de forma objectiva a informação, de tal modo que podemos indicar a sua quantidade e fazer comparações para dizer se uma é maior, menor ou igual.

    Claude Shannon era ateu. Mats já disse que os muçulmanos usam evidências cientíticas, na maioria de cristãos, para promover o "pedófilo Maomé". No entanto, noto que os criacionistas agora usam evidências científicas, na maioria de ateus, para promover profetas, como o pedófilo Moisés (segundos Números 30, ele ordenou que raptassem meninas para que tivessem relações sexuais com ele, com sacerdotes e até com Iavé). Nuns comentários do Talmud Babilónico, essas meninas teriam cerca de três anos e um dia.

    Notei que o Perspectiva fez referência a Carl Sagan. Eu tenho o livro "O Cosmo" na minha neste exacto momento. Já desmascarei uma atribuição incorrecta a Carl Sagan (segunda ela, Sagan admitia que as evidências parecem ser consistentes com um Grande Arquitecto que criou a Vida) [1], [2]. O Perspectiva está a fazer o mesmo. No capítulo XI - "A persistência da memória" - ele fala na Teoria da Informação. Ele por exemplo diz que «para indicar se uma lâmpada está ou não ligada basta 1 bit de informação». Algumas páginas à frente ele diz que a «informação contida na dupla hélice ADN de uma baleia, de um ser humano, ou de qualquer outro animal ou vegetal ou vegetal sobre a Terra está gravada numa linguagem de quatro letras - as quatro diferentes espécies de nucleótidos, os componentes moleculares que formam o ADN». Mais um parte de páginas à frente, está: «A linguagem do cérebro não é a linguagem do ADN dos genes. Tudo aquilo sabemos está codificado em células chamadas neurónios» (...) «O conteúdo de informação do cérebro humano referido em bits é possivelmente comparável ao número total de conexões entre os neurónios - ou seja, cerca de 10^14 bits» (...) «A maior parte dos "livros" estão no córtice cerebral.» Nesta altura o Perspectiva esqueceu-se da lâmpada por causa dos termos usados, como os livros do cérebro.

    Sugiro que o Perspectiva siga o seguinte conselho de Sagan, em "Um Mundo Infestado de Demónios":
    «Quantifique. Se o que está a explicar é uma medida, se envolve alguma quantidade numérica, estará muito mais equipado para descriminar várias hipóteses possíveis. O que é vago e qualitativo está aberto a muitas explicações. Claro que há verdades a serem procuradas nas muitas interpretações qualitativas que somos obrigados a confrontar, mas encontrá-las ainda é mais estimulante.»

    Consegues quantificar a informação para perceber, de forma objectiva, se uma é maior, menor ou igual em relação a outra?

    ResponderEliminar
  121. Eventos cuja probabilidade de acontecimento é superior à probabilidade do Perspectiva algum dia responder à pergunta do aumento de informação:

    #1 Cristo descer à Terra
    #2 O Sporting ganhar a Liga dos Campeões este ano
    #3 José Sócrates perder a arrogância
    #4 Eu transformar-me espontâneamente em sal
    #5 O Ludwig converter-se ao Cristianismo
    #6 O Jónatas, o Mats e o Marcos (juntos) virarem ateus militantes
    #7 Eu transformar a minha Coca-Cola em vinho
    #8 Tatuar a minha testa com a frase «Jesus Cristo é o salvador»
    #9 Haver uma união fraterna entre todos os povos
    #10 Jeová chegar-se ao pé das testemunhas e dizer: «epá, deixem-se de coisas que eu nunca hei de cá vir e transformar a Terra num paraíso»

    ResponderEliminar
  122. Passarei a usar a falácia do preconceito contra os que as usam.

    Mats, repara que quem está a ter paciência é quem responde. E tu revelaste-te como um hipócrita, tal como o Ted Haggard. Criticaste-me por escrever o que entendes serem comentários grandes, mas como podes ver são muito mais pequenos do que os que o fanático do Perspectiva envia. Eu já te desafiei a criticá-lo por isso. Ainda por cima, o advogado mentiroso do Perspectiva é sempre completamente alheio aos assuntos tratados nos artigos. Tal como tu fazes, outro fanático da seita criacionista, mas em menor escala. E tu o louvas por isso, como uma ovelha ranhosa. Além disso, ele não responde, tal como não me responde, e depois diz que os outros não respondem. Criticaste-me por chamar-te "caramelo", depois de teres ofendido um comentador. Mas não criticas o estúpido Perspectiva por fazer pouco dos outros em vez de dar resposta. Achas que esperava alguma coisa de alguém que nunca admitiu um erro.

    O autista Perspectiva já respondeu a esta pergunta do João Vasco: «Qual é a definição objectiva para "aumento de informação?"» ? Parece-me que não. Mas para ti é como se tivesse respondido, mesmo sem ler a resposta.

    Paciência é ler comentários de mais de 5 páginas, de receber palestras de um autista sem relação ao tema em questão, que ignora os outros a não ser quando acha que tem oportunidade de ofender. Ele tem cometido SPAM por diversas vezes, o que é uma das poucas coisas que levam-me a suspender utilizadores que frequentam os meus espaços. E é essa besta que louvas? Por quê? É simples: pertence à seita do criacionismo e escreveu muito.

    Sabes afinal de contas o que é um hipócrita? Eu nem estranhava se fosses homossexual, como o Ted Haggard.

    ResponderEliminar
  123. Copio o comentário do João Vasco.
    Mats,

    Porque é que achas que o Perspectiva não é capaz de responder à pergunta "como é que se define, objectivamente, um aumento de informação"?

    E já agora, sabes tu responder a esta pergunta?


    Deixem o Mats e o Perspectiva responderem. Vou esperar até próximo Domingo. Se não tiver qualquer resposta, fica mais uma para a minha base-de-dados. Depois vemos quem «não consegue refutar os argumentos» de uma «forquilha». [1]

    ResponderEliminar
  124. Perspectiva,

    Quando olhas para uma árvore, a luz que reflecte na árvore e te chega aos olhos contém a imagem da árvore, sob a forma de diferentes raios de luz com diferentes frequências e intensidades. Resultado das características de absorção e reflexão da superfície da árvore.

    Tu sabes interpretar essa informação e reconhecer a árvore, mas dirias que há aí intencionalidade de codificar a imagem da árvore em frequências luminosas?

    Já sei que me vais dizer que há porque foi Deus que fez a luz com uma palavra porque é isso que diz no livro. Mas tenta lembrar-te que é precisamente isso que diz no livro que estamos a discutir, portanto não vale dizer que é porque deus quiz.

    ResponderEliminar
  125. Perspectiva, respondeste uma vez. Boa bola. O problema é que a minha lógica é tão boa como a tua.


    1) Toda a informação codificada tem uma origem inteligente;
    1) O cocó cheira mal -> acho que com isto ninguém discute

    2) o DNA tem informação codificada;
    2) o perspectiva tem cocó -> assumo que a tua função digestiva seja semelhante à maioria dos seres humanos, logo, em certa altura da tua vida, irás ser detentor daquilo que é vulgarmente chamado de "cocó"


    3) o DNA só pode ter tido uma origem inteligente.
    3) o perspectiva cheira mal -> percebes aqui o problema, ou quê? Na tua linda forquilha, tu baseias-te na ideia de que "ter=ser". É um bocado parvo, não?

    ResponderEliminar
  126. Voltando aqui e relendo alguns comentários, verifico que um dos meus contém um erro de transcrição de um acrescento e a falta de outro. Rectifico-o.

    1- (…) Afirmações podem ser refutadas com outras afirmações; são desnecessárias observações. Mas a justificação daquela afirmação permitiria compreender o que é informação codificada e o que é inteligência, e se a inteligência lê a informação codificada que exista ou se a produz, e se a inteligência se produz a si própria ou se é produzida por outra qualquer inteligência.

    2- (…) com informação que o DNA contenha. Mas, além do mais, existem observações refutantes daquela afirmação (que mostram combinações possíveis dos constituintes do DNA, e não outras, que não constituem informação, mas combinações possíveis estáveis), ao passo que não existem observações confirmantes. Não há meio dele compreender (…).

    ResponderEliminar
  127. Perspectiva,
    muito obrigada pela amabilidade da resposta. Decerto marcou mais uns pontos para o céu. Mas não respondeu à minha pergunta. Enfim, não se pode ter tudo, pois não? ;-)
    Tenha un Natal cheio de anjinhos e descanse os dedinhos do copy-paste.
    Cristy

    ResponderEliminar
  128. «Sequências de símbolos não valem nada sem código.»
    Os meus dedos são símbolos. Eu explico a seguir.

    «De resto, uma coisa só é símbolo se uma inteligência lhe adscrever valor simbólico.»
    Levantando o dedo indicador, indico o número 1.
    Com o indicador e o anelar, indico o número 2. Por aí adiante, até ter cinco dedos levantados.
    Se levantar apenas o anelar, estou a mandar alguém para um sítio.
    A mão é código.

    "Cálculo" tem origem no termo latino "calculus", porque pedrinhas eram usadas para cálculo. Por isso também são símbolos de um código. Tudo é código.

    Um código para quem? Será que o perspectiva está a dizer que existe um ser inteligente que está a receber uma receita ou instruções no ADN para fazer proteínas? Como é que diferencia um código de um não código? Por haver uma associação de uma cadeia de elementos que dão um resultado específico?

    «Os criacionistas perguntam: como é que se aumenta objectivamente a informação codificada num telemóvel, num computador ou numa ATM

    A resposta que o Pedro der, se estiver certa para estes sistemas, também estará sempre certa para o DNA.»
    Conta os bits. Se uma mensagem tiver n bits e passar a ter n + 1 bits, houve aumento de informação. Mas se assim for, a informação do ADN aumenta de facto. Como diz que não há aumento de informação, não pode ser essa a definição que dá. Por isso deve indicar a resposta - se quer mostrar que sabe do que fala - em vez de tentar escapadelas.

    O Perspectiva ainda não respondeu à questão.

    ResponderEliminar
  129. Pedro,
    a leitura que eu faço disto tudo, desta agitação obsessiva do perspectiva quase a raiar a esquizofrenia e dos posts "Citação: Informção Gera Funções" , "Resposta ao -COM- Sobre Informação" e outros sobre o mesmo tema, colocados recentemente nos blogs dos lacaios Mats e Sabino é de que as hostes criacionistas estão a passar por uma profunda crise de confiança.
    O spam que o perspectiva faz não é mais que um mecanismo de compensação que ele utiliza para baixar os niveis de ansiedade que as suas próprias dúvidas lhe provocam.
    Ontem assistia à chuva de comentários do jónatas neste post e quase que lhe sentia as descargas de adrenalina.
    Penso, acredito mesmo, que eles já entenderam que se trocaram todos com o conceito de informação, código e significado. Agora estão simplesmente a tentar reescrever e reinterpretar estes conceitos, para tentar baralhar, confundir e enganar algum leitor menos avisado. Infelizmente para eles, pelo menos por aqui, ningúem lhes dá crédito.
    Apesar da seca que é ler os comentários do perspectiva na diagonal foi bastante positivo porque, penso, serviu para que os defensores da teoria da evolução consolidassem ainda mais as suas idéias.
    Pelo menos foi este o sentido que eu retirei de todo este ruído (informação!) que os criacionistas fizeram.

    ResponderEliminar
  130. mama eu quero16/12/08, 23:53

    Elá!
    Isto está animado!

    Tem forquilhas e churrascos, coca-colas e vinho.
    Tem quimica e informática, informação e comunicação.
    Tem telemoveis e até ATMs!
    Tem mentiras e verdades sobre o mestre Sagan.
    Tem mesmo homosexualidade normal e anormal mas... tem muito pouco amor ao próximo.

    Tem acima de tudo emoções.

    Eu gosto.

    ResponderEliminar
  131. Só para deixar o fogacho que na natureza não há de facto homosexualidade.

    Existe homoerotismo. Quero dizer que muitos animais assumem comportamentos homosexuais mas, vinda a época, fazem o que é preciso para ter muitos animalitos.

    E gostava de ver um exemplo de um casal de cisnes machos ou fêmeas.

    De resto acho aberrante a posição da Igreja Católica porque, seja lá porque razão for, ninguém tem o direito de mandar no traseiro dos outros.

    E, num tom mais sério, ninguém tem o direito de ajudar a manter uma situação que no sec XXI ainda leva bastante gente à prisão e, por vezes, à tortura e à morte. Vindo de uma "religião de amor" não está nada mal pensado.

    ResponderEliminar
  132. Wyrm:

    Na natureza há actos homossexuais, mas são os actos homossexuais que a Igreja condena (a homossexualidade nem reconhecem). Por isso o argumento de ser "contra-natura" continua a morrer pela raíz: na natureza há actos homossexuais.

    ResponderEliminar
  133. Prespectiva.

    1-O Carlos Lopes corre como uma gazela.

    2-As gazelas são ruminantes.

    3-Então carlos lopes é uma gazela.

    É mais ou menos isto não é?

    ResponderEliminar
  134. Em relação aos homossexuais, acho esta noticia uma vergonha, é nestas alturas que viro as costas não à minha fé, mas à instituição que supostamente a representa.

    ResponderEliminar
  135. Mats: «nem que para isso eles (os homosexuais) tenham que usar intimidação, violência e tudo o mais (lê sobre a reacção deles quando souberam que os californianos votaram a favor da Proposição 8, que define casamento entre um homem e uma mulher).»

    Pesquisei por "Proposition 8 reaction" no Google... depois fui ao YouTube:
    * Reaction to Prop 8 (Anti-gay marriage) in California
    * m Springs Prop 8 Rally Turns Ugly
    * Christians Assaulted in San Francisco

    Também há isto:
    * Gay Man Murdered in Wake of "Yes on Prop 8" Campaign
    * Murder of gay student sparks outrage, debate
    * Crowd attack («Anti-gay protesters attack a gay during Gay Pridi in Riga, 2006»)
    * Jimmy Swaggart nut case Cult leader says he would kill a gay
    * Ellen on 15-year-old boy killed for being Gay
    * Christians Protest Gays
    * Christian extremists disrupt a Hindu payer at the senate
    * Christians: it's time we finally rise up! Rise Up - Disciple
    * Atheist intolerance
    * The Price of Atheism

    Portanto, concluímos que os cristãos querem obrigar todos a serem como eles, nem que tenham de expulsar pessoas das suas casas, escolas e cidades ou matá-las.

    ResponderEliminar
  136. Man says murder of Kenneth Cummings God's work: «The Houston Chronicle reports that Terry Mark Mangum felt that he was doing God's work in seeking out and murdering a gay man

    I acted in God’s name':«An ultra-Orthodox man suspected of stabbing three people during Jerusalem’s Gay Pride Parade last week says he acted in God’s name. »

    Mats, queres participar num concurso? Enumeras gays que mataram cristãos, e eu enumero os cristãos que mataram gays em nome de Deus. Se a teu argumento inicial for válido, então podemos tirar mais conclusões com isto.

    ResponderEliminar
  137. - com -, há muito pior. Estou à procura de uns comentários no blog do Mats para fundamentar algo que estou a escrever, e encontrei isto: Ateus Mais Propensos à Superstição Que Cristãos. Ele cita um artigo do Wall Street Journal, com o título "Look Who's Irrational Now". Segundo o artigo, baseia-se numa sondagem do Gallup. Fiz uma pesquisa no site do Gallup, mas não encontrei a tal sondagem.

    Agora repara no que está no artigo que o Mats citou:
    «According to the Pew Forum on Religion & Public Life's monumental "U.S. Religious Landscape Survey" that was issued in June, 21% of self-proclaimed atheists believe in either a personal God or an impersonal force. Ten percent of atheists pray at least weekly and 12% believe in heaven

    O artigo da Wall Street Journal é de um espaço de opinião da House of Whorship, que tem muitos outros artigos tão bonitos.

    ResponderEliminar
  138. «Afinal, foi apenas por coincidência que a Europa foi e é precursora no campo dos direitos humanos.»

    Não foi coincidência. Acontecimentos como a revolução francesa e a segunda guerra mundial foram determinantes nisso.

    Mas o cristianismo não me parece que tenha tido um papel fundamental nos direitos humanos como os conhecemos agora. Bem pelo contrário. O estado do vaticano é o único da europa onde a discriminação sexual e religiosa é assumida por lei e onde não há democracia nem liberdade de expressão.

    Isto é a sério ou uma brincadeira de mau gosto? Não acha que está a colocar centenas de católicos (leigos e hierárquia) em causa, que deram a vida pelos outros, na luta pela justiça, liberdade e pelo Bem? Ou só interessa falar em Inquisição sem sequer a perceber historicamente e o contexto em que ela se deu? Sem desculpar muitos do erros que a Igreja cometeu, não acha que em Portugal não só haveria pobreza mas miséria extrema caso a Igreja fechasse todos os centros sociais? Quem é que iria cuidar de milhares de pessoas em probreza extrema (idosos, crianças, mulheres repudiadas pela sociedade, inválidos, entre outros)? O que fariam os bem falantes e os críticos, caso isso acontecesse? onde estão aqueles que apenas teorizam solidadriedade, mas não vão para o terreno, de sandálias e alforge? Os missionário não lhe dizem nada? Bartolomeu de las Casas, ou mesmo o p. António Vieira,por exemplo? Sabe que foi o primeiro a sofrer na pele a morte na luta contra os senhores feudais que escravizavam os Indíos? Isso não parece importar para nada??? Só Inquisição é que importa? Quantos milhares de pessoas morreram à luz da ciência, a bomba atómica? Quanto morrreram aos pés de ditauras hediondas? Quem foram os primeiros a valorizar a mulher e as ciranças, no tempo romano? Os pagãos? Não eram eles, crianças e mulheres, considerados coisas, animais?

    Mas se quer falar em direitos humanos leia por exemplo Act 2, 42ss), carta a Diagoneto ou Picco della Mirandola acerca da Dignidade humana" Se quer falar em direitos humanos vamos analisar os inúmeros documentos da Igreja acerca desta temática, e verificará o que diz revela ignorância extrema.

    Penso que revela uma desonestidade profunda na análise que faz,aliás, tendenciosa e injusta.

    Não percebo como é que um homem da ciência, com inteligência, pactua com tanta falta de rigor histórico e de pensamento.

    ResponderEliminar
  139. «Quantos milhares de pessoas morreram à luz da ciência, a bomba atómica?»

    Eu adoro esta comparação entre a ciência (bomba atómica) e a inquisição.

    A inquisição prendeu e matou gente, assustou muitos mais, enquanto fazia fugir os judeus e destruia a cultura e ciência em Portugal.

    A ciência permitiu, entre outras coisas, que governantes mandassem produzir uma arma, que eles decidiram utilizar.

    Mas é interessante ver quantas vidas é que a ciência e o progresso tiraram à humanidade:

    O mito da violência

    É possível que a Igreja tenha feito bem ao encorajar a acção social. Nunca saberemos, pois é possível que a esmagadora maioria dessa acção social tenha acontecido por amor ao próximo e não por causa das superstições religiosas.
    Hoje grande parte da acção social não vem da Igreja - as pessoas ajudam ou ajudam a ajudar porque sentem o imperativo da solidariedade e não porque querem o seu lugarzinho no céu.

    Até se verifica que os países menos religiosos têm menos pobreza e miséria.

    ResponderEliminar
  140. Não foi só em Porrtugal, claro. Mas Portugal é um exemplo flagrante de como as consequências nefastas da inquisição ultrapassaram em muito as mortes e a dor que infligiu.

    ResponderEliminar

Se quiser filtrar algum ou alguns comentadores consulte este post.